| Sequence ID | dm3.chr3R |
|---|---|
| Location | 10,263,403 – 10,263,469 |
| Length | 66 |
| Max. P | 0.898125 |
| Location | 10,263,403 – 10,263,469 |
|---|---|
| Length | 66 |
| Sequences | 7 |
| Columns | 66 |
| Reading direction | reverse |
| Mean pairwise identity | 72.81 |
| Shannon entropy | 0.56380 |
| G+C content | 0.36314 |
| Mean single sequence MFE | -10.20 |
| Consensus MFE | -6.35 |
| Energy contribution | -6.26 |
| Covariance contribution | -0.10 |
| Combinations/Pair | 1.69 |
| Mean z-score | -1.05 |
| Structure conservation index | 0.62 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.14 |
| SVM RNA-class probability | 0.898125 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 10263403 66 - 27905053 CCAGCAUCUUUCUCAUCUUGUUUGUUUAAGUUUUUGACAAACUUAUUAUGCACUCAGCGGGAUAUA ..............(((((((((((.(((((((.....)))))))....)))...))))))))... ( -11.00, z-score = -1.23, R) >droAna3.scaffold_13340 437095 65 - 23697760 CCAGCUCCAGCUCCAGCUUAUUUGUUUAA-UUUUUGACAAACUUAUUAUGCGCUCCGCGGGAUGUA ...((((((((....)))..((((((...-.....)))))).......((((...))))))).)). ( -10.20, z-score = 0.41, R) >droEre2.scaffold_4770 9796262 64 - 17746568 CCAGC-UCUUUCCCCUCUUGUUUGCCUAA-UUUUUGACAAACUUAUUAUGCACUCAGCGGGAUAUA .....-....((((.....(((((.(...-.....).))))).......((.....)))))).... ( -10.10, z-score = -1.00, R) >droYak2.chr3R 12655659 65 + 28832112 CCACC-UCUUUCCCAGCUUGUUUGUUUAAUUUUUUGACAAACUUAUUAUGCACUCAGCGGGAUAUA .....-....((((.....(((((((.........))))))).......((.....)))))).... ( -12.90, z-score = -2.50, R) >droSec1.super_0 9342856 65 + 21120651 CCAGC-UCUUUCUCAUCUUGUUUGUUAAAUUUUUUGACAAACUUAUUAUGCACUCAGCGGGAUAUA .....-....((((.....(((((((((.....))))))))).......((.....)))))).... ( -12.10, z-score = -2.27, R) >droSim1.chr3R 16323517 65 + 27517382 CCAGC-UCUUUCUCAACUUGUUUGUUUAAUUUUUUGACAAACUUAUUAUGCACUCAGCGGGAUAUA .....-....((((.....(((((((.........))))))).......((.....)))))).... ( -9.90, z-score = -1.32, R) >droWil1.scaffold_181089 2338388 58 + 12369635 -UGAUUUGCCUUUUUUCCUAUUUGGAUAUCUGUAUG-UACGUAUGUUGAAGAGUUUAUGA------ -........((((((..((((.((.(((....))).-)).))).)..)))))).......------ ( -5.20, z-score = 0.57, R) >consensus CCAGC_UCUUUCUCAUCUUGUUUGUUUAAUUUUUUGACAAACUUAUUAUGCACUCAGCGGGAUAUA ..........((((.....(((((((.........))))))).......((.....)))))).... ( -6.35 = -6.26 + -0.10)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:15:04 2011