| Sequence ID | dm3.chr3R |
|---|---|
| Location | 9,406,359 – 9,406,442 |
| Length | 83 |
| Max. P | 0.719716 |
| Location | 9,406,359 – 9,406,442 |
|---|---|
| Length | 83 |
| Sequences | 6 |
| Columns | 83 |
| Reading direction | reverse |
| Mean pairwise identity | 73.57 |
| Shannon entropy | 0.52117 |
| G+C content | 0.30271 |
| Mean single sequence MFE | -12.28 |
| Consensus MFE | -7.40 |
| Energy contribution | -8.02 |
| Covariance contribution | 0.61 |
| Combinations/Pair | 1.25 |
| Mean z-score | -1.00 |
| Structure conservation index | 0.60 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.50 |
| SVM RNA-class probability | 0.719716 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 9406359 83 - 27905053 AGUCGAGCAAUAAUUCAGGAAAUUAUUAUUGGGGUUUAUUUAAAUUUAACAGUUCGAACGCAUACUCAAUUUGGAAUAUUUCA ..(((((((((((((.....)))))))....((((((....))))))....)))))).......................... ( -9.10, z-score = 0.08, R) >droSec1.super_0 8519626 83 + 21120651 AGUCGAGUAAUAAUGCAGGAAAUUAUUAUUCGGGUUUAUUUAAAUUUAACAGUUCGAACGCAUACUCAAUUAGGGAUAUUUCA .(((((((((((((.......))))))))))((((...((..(((......)))..)).....)))).......)))...... ( -12.60, z-score = -1.17, R) >droYak2.chr3R 13715393 83 - 28832112 AGUCGAGUAAUAAUGCAGGAAAUUGUUAUUCGGGUUUAUUUAAAUUUAACAGUUCGAACGCAUACUCAAUUAAGGAAAUUCCA ....((((((((((.......))))))))))((((...((..(((......)))..)).....))))......((.....)). ( -12.90, z-score = -0.68, R) >droEre2.scaffold_4770 5510823 83 + 17746568 AGUCGAGUAAUAAUGCAGGAAAUUAUUAUUCGGGUUUAUUUAAAUUAAACAGCUCGAACGCAUACUCAAUAAAGGAAAUUUCA ..((((((((((((.......))))))))))))(((((.......))))).((......))...................... ( -14.40, z-score = -1.93, R) >droPer1.super_0 8276053 76 + 11822988 -GCUGAGCAUUAAUGCAUGAAAUUAUUA---AGACUC---UAGGUUAGACACUCUUAAUAUAUCUUUGUGUUACACUUUUUCA -.........(((((((.((...(((((---(((.((---((...))))...))))))))..))..))))))).......... ( -11.00, z-score = -0.25, R) >droSim1.chr3R 15499456 68 + 27517382 AGUCGAGUAAUAAUGCAAGAAAUUAUUAUUCGGGUUUAUUUAAAUUUAACAGUUCGAACGCGAAUCCA--------------- ....((((((((((.......))))))))))((((((.((..(((......)))..))...)))))).--------------- ( -13.70, z-score = -2.05, R) >consensus AGUCGAGUAAUAAUGCAGGAAAUUAUUAUUCGGGUUUAUUUAAAUUUAACAGUUCGAACGCAUACUCAAUUAAGGAUAUUUCA ..((((((((((((.......)))))))))))).................................................. ( -7.40 = -8.02 + 0.61)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:12:28 2011