| Sequence ID | dm3.chr3R |
|---|---|
| Location | 9,339,477 – 9,339,527 |
| Length | 50 |
| Max. P | 0.812959 |
| Location | 9,339,477 – 9,339,527 |
|---|---|
| Length | 50 |
| Sequences | 11 |
| Columns | 51 |
| Reading direction | reverse |
| Mean pairwise identity | 86.38 |
| Shannon entropy | 0.29465 |
| G+C content | 0.41326 |
| Mean single sequence MFE | -13.75 |
| Consensus MFE | -7.12 |
| Energy contribution | -7.22 |
| Covariance contribution | 0.10 |
| Combinations/Pair | 1.20 |
| Mean z-score | -2.59 |
| Structure conservation index | 0.52 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.77 |
| SVM RNA-class probability | 0.812959 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 9339477 50 - 27905053 AAAACUGAACAAGUGAAAAAUCGCCAUGAAAAUGGCAAGCGC-UUGGCCAU .....((..((((((.......(((((....)))))...)))-)))..)). ( -15.90, z-score = -3.57, R) >droSim1.chr3R 15435962 50 + 27517382 AAAACUGAACAAGUGAAAAAUCGCCAUGAAAAUGGCAAGCGC-UUGGCCAU .....((..((((((.......(((((....)))))...)))-)))..)). ( -15.90, z-score = -3.57, R) >droSec1.super_0 8455837 50 + 21120651 AAAACUGAACAAGUGAAAAAUCGCCAUGAAAAUCGCAAGCGC-UUGGCCAU .....((..((((((.......((.((....)).))...)))-)))..)). ( -9.40, z-score = -1.06, R) >droYak2.chr3R 13648831 50 - 28832112 AAAACUGAACAAGUGAAAAAUCGCCAUGAAAAUGGCAAGCGC-UUGGCCAU .....((..((((((.......(((((....)))))...)))-)))..)). ( -15.90, z-score = -3.57, R) >droEre2.scaffold_4770 5445232 50 + 17746568 AAAACUGAACAAGUGAAAAAUCGCCAUGAAAAUGGCAAGCGC-UUGGCCAU .....((..((((((.......(((((....)))))...)))-)))..)). ( -15.90, z-score = -3.57, R) >droAna3.scaffold_13340 1895646 50 - 23697760 AAAACUGUACAAGUGAAAAAUCGCCAUGAAAAUGGCAAGCGC-UUGGCCAU .....((..((((((.......(((((....)))))...)))-)))..)). ( -15.90, z-score = -3.27, R) >dp4.chr2 16784814 50 - 30794189 AAACCCGUACAAGUGAAAAAUCGCCAUGAAAAUGGCAAACGC-UUGGCCAU ......(..((((((.......(((((....)))))...)))-)))..).. ( -14.50, z-score = -3.03, R) >droPer1.super_0 8213784 50 + 11822988 AAACCCGUACAAGUGAAAAAUCGCCAUGAAAAUGGCAAACGC-UUGGCCAU ......(..((((((.......(((((....)))))...)))-)))..).. ( -14.50, z-score = -3.03, R) >droWil1.scaffold_181130 6411455 50 - 16660200 AAAACUAUACAAGUGAAAAAUUGCCACGCAAAUGGCAGGCGC-UUGGCCAU .........((((((.....((((((......)))))).)))-)))..... ( -14.50, z-score = -1.98, R) >droVir3.scaffold_13047 9135139 51 - 19223366 AAAACGUUGCCAAUGAAAAAUUGCACUGUAAAUUGCAUGUGCUUUGGCUAU ........(((((.........(((((((.....))).)))).)))))... ( -11.60, z-score = -1.40, R) >droMoj3.scaffold_6540 2638049 51 + 34148556 AAAACGUUACCACUGAAAAAUCGCACUGUAAAUUGCAUGUGCUUUAGCUAU .....((((.....((....))(((((((.....))).))))..))))... ( -7.30, z-score = -0.46, R) >consensus AAAACUGUACAAGUGAAAAAUCGCCAUGAAAAUGGCAAGCGC_UUGGCCAU ......................(((((....)))))............... ( -7.12 = -7.22 + 0.10)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:12:02 2011