Sequence ID | dm3.chr3R |
---|---|
Location | 8,560,133 – 8,560,195 |
Length | 62 |
Max. P | 0.732689 |
Location | 8,560,133 – 8,560,195 |
---|---|
Length | 62 |
Sequences | 8 |
Columns | 66 |
Reading direction | reverse |
Mean pairwise identity | 58.42 |
Shannon entropy | 0.87206 |
G+C content | 0.34401 |
Mean single sequence MFE | -8.45 |
Consensus MFE | -2.55 |
Energy contribution | -3.48 |
Covariance contribution | 0.92 |
Combinations/Pair | 1.43 |
Mean z-score | -1.22 |
Structure conservation index | 0.30 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 0.53 |
SVM RNA-class probability | 0.732689 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 8560133 62 - 27905053 AAAAAUUCCAUCUUUAUAACAAUACAGUAAUCUUCGGAUUAUUAUUUU-CGACUACCCGGCAC--- .........................(((((((....)))))))....(-((......)))...--- ( -7.60, z-score = -1.74, R) >droWil1.scaffold_181089 11282766 57 - 12369635 ---------GCUUCAAGAGAAAGACCACAAGCUUCAGGUUCAGCUUCAGCUUCAUCUCCUCCUUUC ---------.......(((((((.....(((((........)))))...)))..))))........ ( -7.20, z-score = 0.67, R) >droEre2.scaffold_4770 4658523 60 + 17746568 AAAAAUUCCAUCUUUGUAACAAUACAGUAAUCUUUGGAUUAUUUUCUU---ACUACCCCGCAC--- ......((((...(((((....))))).......))))..........---............--- ( -4.50, z-score = -0.60, R) >droYak2.chr3R 12847786 63 - 28832112 AAAUAUACCAUUUGUGUACCAAUACAGUAAUCUUCGGAUUAUUUUUUUUCGACUCCCCGGCAC--- .......((...(((((....)))))((((((....))))))................))...--- ( -9.90, z-score = -1.51, R) >droSec1.super_0 7695200 62 + 21120651 AGGAAUUCCAUCUUUGCAACAAUACAGUAAUCUUCGGAUUAUUAUUUU-CGACUACCCGACAC--- .((....))................(((((((....)))))))....(-((......)))...--- ( -10.20, z-score = -2.06, R) >droSim1.chr3R 14655698 62 + 27517382 AAAAAUUCCAUCUUAGUAGCAAUACAGUAAUCUUCGGAUUAUUAUUUU-CGACUACCCGACAC--- ...............(((....)))(((((((....)))))))....(-((......)))...--- ( -10.90, z-score = -3.07, R) >anoGam1.chr3R 25980749 61 + 53272125 AUAAAUCUGUUUUAAAUAACAUCAUAUCAAUCUUCGGAGGAAUAUAUC-CUACUACUAGGAA---- .......((((......))))..((((...((....))...)))).((-(((....))))).---- ( -8.40, z-score = -1.01, R) >triCas2.ChLG4 11681140 63 - 13894384 AGCUCAGCCAUUUUGAUAAUAAGUUAGUUAAAAUGAGAAUGAUCAAUUUGGAUUGUACAGAAA--- .(..((((((..(((((.....(((......))).......)))))..))).)))..).....--- ( -8.90, z-score = -0.44, R) >consensus AAAAAUUCCAUCUUUAUAACAAUACAGUAAUCUUCGGAUUAUUAUUUU_CGACUACCCGGCAC___ .........................(((((((....)))))))....................... ( -2.55 = -3.48 + 0.92)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:09:53 2011