| Sequence ID | dm3.chr3R |
|---|---|
| Location | 8,017,649 – 8,017,707 |
| Length | 58 |
| Max. P | 0.994258 |
| Location | 8,017,649 – 8,017,707 |
|---|---|
| Length | 58 |
| Sequences | 3 |
| Columns | 64 |
| Reading direction | forward |
| Mean pairwise identity | 92.71 |
| Shannon entropy | 0.10044 |
| G+C content | 0.52137 |
| Mean single sequence MFE | -21.70 |
| Consensus MFE | -18.57 |
| Energy contribution | -18.90 |
| Covariance contribution | 0.33 |
| Combinations/Pair | 1.00 |
| Mean z-score | -1.55 |
| Structure conservation index | 0.86 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.03 |
| SVM RNA-class probability | 0.508116 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 8017649 58 + 27905053 GGCCAGAAGCCGAAGCUACA------ACUGCAGCUACAGCUAAGGCUAAAGCUGGUAGCUAAAG (((.....)))..((((((.------....(((((..(((....)))..))))))))))).... ( -20.00, z-score = -1.42, R) >droSec1.super_0 7162038 64 - 21120651 GGCCAGAAGCCGAAGCUACAGCUACAACUGCAGCUACAGCUAAGGCUAAAGCUGGUAGCUAAAG .(((((.((((..((((..((((.(....).))))..))))..))))....)))))........ ( -23.00, z-score = -1.69, R) >droSim1.chr3R 14142959 64 - 27517382 GGCCAGAAGCCGAAGCUACAGCUACAACUGCAGCUACAGCUAAGGCCAAAGCUGGUAGCUAAAG (((.....)))..((((((((((.(....).)))).(((((........))))))))))).... ( -22.10, z-score = -1.53, R) >consensus GGCCAGAAGCCGAAGCUACAGCUACAACUGCAGCUACAGCUAAGGCUAAAGCUGGUAGCUAAAG (((.....)))(.((((.(((......))).)))).)(((((.(((....)))..))))).... (-18.57 = -18.90 + 0.33)
| Location | 8,017,649 – 8,017,707 |
|---|---|
| Length | 58 |
| Sequences | 3 |
| Columns | 64 |
| Reading direction | reverse |
| Mean pairwise identity | 92.71 |
| Shannon entropy | 0.10044 |
| G+C content | 0.52137 |
| Mean single sequence MFE | -27.17 |
| Consensus MFE | -25.73 |
| Energy contribution | -26.40 |
| Covariance contribution | 0.67 |
| Combinations/Pair | 1.00 |
| Mean z-score | -2.86 |
| Structure conservation index | 0.95 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.68 |
| SVM RNA-class probability | 0.994258 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 8017649 58 - 27905053 CUUUAGCUACCAGCUUUAGCCUUAGCUGUAGCUGCAGU------UGUAGCUUCGGCUUCUGGCC ....(((.....)))...(((..(((((.((((((...------.)))))).)))))...))). ( -22.70, z-score = -2.12, R) >droSec1.super_0 7162038 64 + 21120651 CUUUAGCUACCAGCUUUAGCCUUAGCUGUAGCUGCAGUUGUAGCUGUAGCUUCGGCUUCUGGCC .........((((....((((..((((((((((((....))))))))))))..)))).)))).. ( -28.30, z-score = -2.97, R) >droSim1.chr3R 14142959 64 + 27517382 CUUUAGCUACCAGCUUUGGCCUUAGCUGUAGCUGCAGUUGUAGCUGUAGCUUCGGCUUCUGGCC ....(((.....)))..((((..(((((.(((((((((....))))))))).)))))...)))) ( -30.50, z-score = -3.49, R) >consensus CUUUAGCUACCAGCUUUAGCCUUAGCUGUAGCUGCAGUUGUAGCUGUAGCUUCGGCUUCUGGCC ....(((.....)))...(((..(((((.(((((((((....))))))))).)))))...))). (-25.73 = -26.40 + 0.67)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:08:24 2011