| Sequence ID | dm3.chr3R |
|---|---|
| Location | 7,688,051 – 7,688,117 |
| Length | 66 |
| Max. P | 0.729304 |
| Location | 7,688,051 – 7,688,117 |
|---|---|
| Length | 66 |
| Sequences | 10 |
| Columns | 75 |
| Reading direction | reverse |
| Mean pairwise identity | 81.49 |
| Shannon entropy | 0.35913 |
| G+C content | 0.33846 |
| Mean single sequence MFE | -15.56 |
| Consensus MFE | -12.17 |
| Energy contribution | -12.22 |
| Covariance contribution | 0.05 |
| Combinations/Pair | 1.38 |
| Mean z-score | -1.22 |
| Structure conservation index | 0.78 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.52 |
| SVM RNA-class probability | 0.729304 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 7688051 66 - 27905053 --------AAUUUUCUGAUUUAUUUGCGC-AGCAAGCGCGAAAUGAAAAAUUGCGUAAGCAGUGGAAUUACUUUU --------....((((..(((((((((((-.....)))).)))))))..(((((....)))))))))........ ( -18.20, z-score = -1.70, R) >droSim1.chr3R 13808865 66 + 27517382 --------AAUUUUCUGAUUUAUUUGCGC-AGCAAGCGCGAAAUGAAAAAUUGCGUAAGCAGUGGAAUUACUUUU --------....((((..(((((((((((-.....)))).)))))))..(((((....)))))))))........ ( -18.20, z-score = -1.70, R) >droSec1.super_0 6839016 66 + 21120651 --------AAUUUUCUGAUUUAUUUGCGC-AGCAAGCGCGAAAUGAAAAAUUGCGUAAGCAGUGGAAUAACUUUU --------....((((..(((((((((((-.....)))).)))))))..(((((....)))))))))........ ( -18.20, z-score = -1.73, R) >droYak2.chr3R 12098247 66 + 28832112 --------AAUUUUCUGAUUUAUUUGCGC-AGCAAGCGCGAAAUGAAAAAUUGCGUAAGCAGUGGAAUUACUUUU --------....((((..(((((((((((-.....)))).)))))))..(((((....)))))))))........ ( -18.20, z-score = -1.70, R) >droEre2.scaffold_4770 3813857 66 + 17746568 --------AAUUUUCUGAUUUAUUUGCGC-AGCAAGCGCGAAAUGAAAAAUUGCGUAAGCAGUGGAAUUACUUUU --------....((((..(((((((((((-.....)))).)))))))..(((((....)))))))))........ ( -18.20, z-score = -1.70, R) >droAna3.scaffold_12911 2342036 66 - 5364042 --------AAUCUGCUGAUUUAUUUGUGC-AGCCAGCGCGAAAUGAAAAAUUGCGUAAGCGGAGAAAUUACUUUC --------..(((.(...(((((((((((-.....)))).))))))).....((....))).))).......... ( -14.90, z-score = -0.74, R) >droWil1.scaffold_181130 894998 75 + 16660200 AAUAAAAAUCAUUACUUAUUUAUUUGCGCAUUUGAGCGCGAAAUGAAAAAUUGCGUAAGAACCGAAAUUACAUUU ..................(((((((((((......)))).))))))).......((((.........)))).... ( -11.40, z-score = -0.13, R) >droVir3.scaffold_13047 14896057 63 + 19223366 -----------UUUCUUAUUUAUUUGAGC-UCUGAGCGCGGAAUGAAAUAUUGUGCAGGCAAUGAAAUUACAUUU -----------.......(((((((..((-.....))...))))))).((((((....))))))........... ( -7.60, z-score = 1.19, R) >droMoj3.scaffold_6540 22036745 63 - 34148556 -----------UUUCUUAUUUAUUUGAGC-GCUGAGCGCGAAAUGAAAUAUUGCGCAAGCAAUGAAAUUACAUUU -----------.......(((((((..((-((...)))).))))))).((((((....))))))........... ( -17.30, z-score = -2.04, R) >droGri2.scaffold_14906 4357500 63 + 14172833 -----------UUUCUUAUUUAUUUGAGC-GCUGAACUCGAAAUGAAAUAUUGCGCAAGCAAUGAAAUUACAUUU -----------.......((((((((((.-......))).))))))).((((((....))))))........... ( -13.40, z-score = -1.91, R) >consensus ________AAUUUUCUGAUUUAUUUGCGC_AGCAAGCGCGAAAUGAAAAAUUGCGUAAGCAGUGAAAUUACUUUU ..................(((((((((((......)))).)))))))..(((((....)))))............ (-12.17 = -12.22 + 0.05)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:07:44 2011