Sequence ID | dm3.chr3R |
---|---|
Location | 7,411,503 – 7,411,598 |
Length | 95 |
Max. P | 0.935101 |
Location | 7,411,503 – 7,411,598 |
---|---|
Length | 95 |
Sequences | 5 |
Columns | 102 |
Reading direction | forward |
Mean pairwise identity | 63.69 |
Shannon entropy | 0.64586 |
G+C content | 0.28991 |
Mean single sequence MFE | -13.35 |
Consensus MFE | -4.96 |
Energy contribution | -4.88 |
Covariance contribution | -0.08 |
Combinations/Pair | 1.56 |
Mean z-score | -1.93 |
Structure conservation index | 0.37 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 1.39 |
SVM RNA-class probability | 0.935101 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 7411503 95 + 27905053 -----AAAAACGAACACGGAAUUUAAAAGUGAAAUAUACUUUCAUGGUUUCAGUAAAAGACACUGCAUAAUA--CAAUAUGCAAAUCGAAUACACUCGCAUU -----.....(((....((((((..((((((.....))))))...)))))).(((...((...((((((...--...))))))..))...)))..))).... ( -14.80, z-score = -1.78, R) >droYak2.chr3R 11820124 85 - 28832112 AAACACUAAACUAACACAGAAUUUAAAAGGGAAAUACAUUUCCACAGUUUUAAAAAUAAACACUGCAUAACA--CAAUAUGCAAAUA--------------- .....................(((((((.(((((....)))))....))))))).........((((((...--...))))))....--------------- ( -11.00, z-score = -3.52, R) >droSec1.super_0 6567437 100 - 21120651 AAAAACAAAACGAACACAGAAUUUAAAAGUGAAAUAUACUUUCACGGUUUCAGUAAAAGACACUGCCUAAUA--CAAUAUGCAAAUCGAAUACACUAGCAUU ..........(((...............((((((.....))))))((...((((.......)))))).....--...........))).............. ( -9.90, z-score = -0.39, R) >droSim1.chr3R 13532059 100 - 27517382 AAAAACAAAACGAACACAGAAUUUAAAAGUGAAAUAUACUUUCACGGUUUCAGUAAAAGACACUGCAUAAUA--CAAUAUGCAAAUCGAAUACACUAGCAUU ............................((((((.....)))))).(((...(((...((...((((((...--...))))))..))...)))...)))... ( -13.40, z-score = -2.05, R) >droWil1.scaffold_181130 12343287 88 + 16660200 AGUUCUAUGGUAAAAAUAGGAUUAUGAGUCAAAGUAGAAUGAU---GUCUCUGUGGGGGGCAAUAAAUCAUUUUCAAUAAUUACUUAUAAU----------- .(((((((.......)))))))(((((((......((((((((---(((((.....)))))).....)))))))........)))))))..----------- ( -17.64, z-score = -1.91, R) >consensus AAAAACAAAACGAACACAGAAUUUAAAAGUGAAAUAUACUUUCACGGUUUCAGUAAAAGACACUGCAUAAUA__CAAUAUGCAAAUCGAAUACACU_GCAUU ............................((((((.....)))))).((((.......))))..((((((........))))))................... ( -4.96 = -4.88 + -0.08)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:06:59 2011