| Sequence ID | dm3.chr3R |
|---|---|
| Location | 7,279,705 – 7,279,795 |
| Length | 90 |
| Max. P | 0.507421 |
| Location | 7,279,705 – 7,279,795 |
|---|---|
| Length | 90 |
| Sequences | 5 |
| Columns | 106 |
| Reading direction | forward |
| Mean pairwise identity | 82.88 |
| Shannon entropy | 0.28496 |
| G+C content | 0.33642 |
| Mean single sequence MFE | -21.88 |
| Consensus MFE | -13.58 |
| Energy contribution | -14.14 |
| Covariance contribution | 0.56 |
| Combinations/Pair | 1.17 |
| Mean z-score | -1.88 |
| Structure conservation index | 0.62 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.03 |
| SVM RNA-class probability | 0.507421 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 7279705 90 + 27905053 --------------UUUUAAAUUG--UAUUUUGCGUGCGAGCUGUUUGUUUACAUUUAUUUUCGUGAAUUCCUUAGCGUGGCGCAAACAAGUUCAAUUUUAACUUU --------------....((((((--...((((..((((.((((...((((((..........))))))....))))....))))..))))..))))))....... ( -19.50, z-score = -1.57, R) >droEre2.scaffold_4770 3405755 90 - 17746568 --------------UUUUAAAUUG--UGUUUUGCGUGUGAGCUGUUUGUUUACAUUUAUUCUCGUGAAUUUCUUAGCGUGGCGCAAACAAGUUCAAUUUCAACUUU --------------.......(((--(((..(((((((((((.....))))))))..((((....))))......)))..))))))..(((((.......))))). ( -19.60, z-score = -1.40, R) >droYak2.chr3R 11314073 90 + 28832112 --------------UUUUAAAUUG--UGUUUUGCGUGCGAGCUGUUUGUUUACAUUUAUUUUCGUGCAUUCCUUAGCGCGGCGCAAACAAGUUCAAUUUGAACUUU --------------.(((((((((--(((((.(((((..(((.....)))..).........(((((........))))))))))))))....))))))))).... ( -23.00, z-score = -1.55, R) >droSec1.super_0 6436686 98 - 21120651 UUUUAAAUUUUUUUUUGCGAGCUGCUUUUUUUGCUUGCGAGCUGUUUGUUUACAUUUAU--------AUUCCUUGGCGUGGCGCAAACAAGUUCAAUUUUAACUUU ................((((((..........))))))(((((((((((...(((...(--------(.....))..)))..)))))).)))))............ ( -20.80, z-score = -1.13, R) >droSim1.chr3R_random 445188 90 + 1307089 --------------UUUUAAAUUG--UGUUUUGCUUGCGAGCUGUUUGUUUACAUUUAUAUUCGUGAAUUCCUUAGCGUGGCGCAAGCAAGUUCAAUUUUAACUUU --------------....((((((--...((((((((((.((((...((((((..........))))))....))))....))))))))))..))))))....... ( -26.50, z-score = -3.77, R) >consensus ______________UUUUAAAUUG__UGUUUUGCGUGCGAGCUGUUUGUUUACAUUUAUUUUCGUGAAUUCCUUAGCGUGGCGCAAACAAGUUCAAUUUUAACUUU ..................((((((.....((((..((((.((((...((((((..........))))))....))))....))))..))))..))))))....... (-13.58 = -14.14 + 0.56)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:06:24 2011