| Sequence ID | dm3.chr3R |
|---|---|
| Location | 6,813,342 – 6,813,437 |
| Length | 95 |
| Max. P | 0.581929 |
| Location | 6,813,342 – 6,813,437 |
|---|---|
| Length | 95 |
| Sequences | 5 |
| Columns | 100 |
| Reading direction | forward |
| Mean pairwise identity | 63.00 |
| Shannon entropy | 0.62532 |
| G+C content | 0.31792 |
| Mean single sequence MFE | -14.69 |
| Consensus MFE | -9.36 |
| Energy contribution | -8.76 |
| Covariance contribution | -0.60 |
| Combinations/Pair | 1.33 |
| Mean z-score | -0.21 |
| Structure conservation index | 0.64 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.18 |
| SVM RNA-class probability | 0.581929 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 6813342 95 + 27905053 AUUAUUAUUGUUGUUUUAUCGCUGCUGCAACUGUUUUUUUUUCUUCUUGUCAACAAGCAGCUAU-----GCAUCAUGAAUAUUUUAAAAUACAAAAUUAU .......((((.((((((..((((((.............................))))))(((-----(...)))).......))))))))))...... ( -11.35, z-score = 0.89, R) >droSec1.super_0 5975175 93 - 21120651 AUUAUUAUUGUUGUUUUAUCGCCGCUGCCACUGUUGUUUUUUU--CUUGUCAGCAAGCAGCGAU-----GCAUCAUGAAUAUAUUAAAAUACAAGAUUCU .......((((.((((((....((((((...(((((.......--.....))))).))))))((-----(...)))........))))))))))...... ( -15.70, z-score = 0.04, R) >droYak2.chr3R 10847096 91 + 28832112 AUUAUUAUUGUUGUUUUUUCGACGCUGCCAGUGUUGUUUUUU---CUUGUCAACA-GCAGCGAU-----GCAUCAUGAAUAUAUUAAAAUACAAAGUUAU .........((((......))))(((((...(((((......---.....)))))-)))))...-----............................... ( -14.20, z-score = 0.37, R) >droWil1.scaffold_181130 7544087 73 + 16660200 --AUUUAUCAUUGCUCU-----UGUUGCUAGUGUUG-CACAGCAUUA---CAGCAGGCAACAGA-----GCAUCAUGAAUAUAUUAAAA----------- --((((((...((((((-----.((((((..(((((-..........---))))))))))))))-----)))..)))))).........----------- ( -21.80, z-score = -2.62, R) >droMoj3.scaffold_6540 21337875 82 + 34148556 ------GUUAUUGUUUU-----UAUUGCAAUUGUUUUCACAGCACGAUGUCAACAGGCAACAGACAACAGCCCCAUGAAUAUAUUUAAAUAAA------- ------(((.((((((.-----..((((...((((...(((......))).)))).)))).)))))).)))......................------- ( -10.40, z-score = 0.25, R) >consensus AUUAUUAUUGUUGUUUU_UCG_UGCUGCAACUGUUGUUUUUUC__CUUGUCAACAAGCAGCAAU_____GCAUCAUGAAUAUAUUAAAAUACAA__UU_U .......(((((((........((((((...(((((..............))))).)))))).......)))..))))...................... ( -9.36 = -8.76 + -0.60)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:04:48 2011