| Sequence ID | dm3.chr3R |
|---|---|
| Location | 6,275,519 – 6,275,613 |
| Length | 94 |
| Max. P | 0.965562 |
| Location | 6,275,519 – 6,275,613 |
|---|---|
| Length | 94 |
| Sequences | 6 |
| Columns | 94 |
| Reading direction | forward |
| Mean pairwise identity | 69.83 |
| Shannon entropy | 0.55436 |
| G+C content | 0.54650 |
| Mean single sequence MFE | -17.22 |
| Consensus MFE | -7.08 |
| Energy contribution | -8.64 |
| Covariance contribution | 1.56 |
| Combinations/Pair | 1.28 |
| Mean z-score | -2.31 |
| Structure conservation index | 0.41 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.75 |
| SVM RNA-class probability | 0.965562 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 6275519 94 + 27905053 UCCAACCGCCACCUCGCCAUGUCCUGUGCUGCAGUUUUACCCCAUCCAUUCAGCAAGGACCUCCUUCCAUUCCGAAUUCUUUCUUGCGAGUAAG ............(((((...(((((.(((((.(((............))))))))))))).............(((....)))..))))).... ( -19.30, z-score = -2.97, R) >droSim1.chr3R 12402443 94 - 27517382 UCCACCCGCCACCUCGCCAUGUCCUGUGCUGCAGUUUUACCCCGUCCAUUCAGCAAGGACCUCCUUCCAUUCCGAAUUCUUUCUUGCGAGUAAG ............(((((...(((((.(((((.(((............))))))))))))).............(((....)))..))))).... ( -19.30, z-score = -2.70, R) >droSec1.super_0 5455066 94 - 21120651 UCCACCCGCCACCUCGCCAUGUCCUGUGCUGCAGUUUUACCCCAUCCAUUCAGCAAGGACCUCCUUCCAAUCCGAAUUCUUUCUUGCGAGUAAG ............(((((...(((((.(((((.(((............))))))))))))).............(((....)))..))))).... ( -19.30, z-score = -3.01, R) >droYak2.chr3R 10305521 84 + 28832112 ----------ACCAACCAUCCUUCCAUGCUGCAUUUUUACCCCAUCCAUUUAGCGAGGACCUCCCUCCCUUCCGAAUUCCUUCUUGCGAGUAAG ----------................(((((((..................((.((((.....)))).))...(((....))).))).)))).. ( -10.30, z-score = -1.32, R) >droEre2.scaffold_4770 2407454 85 - 17746568 ---------UCCCUCGCCCUGUCCUGUGCUGCAUUUUCACCCCAUCCAUUUAGCAAGGACCUCCUUCCAUUCCGAAUUCCUUCCUGCGAGUAAG ---------...(((((...(((((.(((((...................)))))))))).............(((....)))..))))).... ( -16.01, z-score = -2.75, R) >droAna3.scaffold_13340 22877281 78 - 23697760 -----------CCCAACAUC--CCUGCCCUGCCCUGCCGUGUACUGCACUU-GCAGGA--CACCCACCCACCCACCUCAUCCUCUGCGAGUGGG -----------.........--.......((.(((((.(((.....)))..-))))).--))........((((((.((.....)).).))))) ( -19.10, z-score = -1.10, R) >consensus _________CACCUCGCCAUGUCCUGUGCUGCAGUUUUACCCCAUCCAUUCAGCAAGGACCUCCUUCCAUUCCGAAUUCUUUCUUGCGAGUAAG ............(((((...(((((.(((((...................)))))))))).............(((....)))..))))).... ( -7.08 = -8.64 + 1.56)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:03:01 2011