| Sequence ID | dm3.chr2L |
|---|---|
| Location | 6,810,697 – 6,810,748 |
| Length | 51 |
| Max. P | 0.880658 |
| Location | 6,810,697 – 6,810,748 |
|---|---|
| Length | 51 |
| Sequences | 9 |
| Columns | 65 |
| Reading direction | forward |
| Mean pairwise identity | 70.72 |
| Shannon entropy | 0.52213 |
| G+C content | 0.36327 |
| Mean single sequence MFE | -9.68 |
| Consensus MFE | -5.91 |
| Energy contribution | -5.78 |
| Covariance contribution | -0.14 |
| Combinations/Pair | 1.12 |
| Mean z-score | -1.24 |
| Structure conservation index | 0.61 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.05 |
| SVM RNA-class probability | 0.880658 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr2L 6810697 51 + 23011544 AAAAUACGCCGUUGUAUAGGCAAUAAAAACGCUUAUUGCUCCACGUUUGCC-------------- .......((...(((...((((((((......))))))))..)))...)).-------------- ( -9.30, z-score = -0.65, R) >droSim1.chr2L_random 387094 51 + 909653 AAAAUACGCCGUUGUAUAGGCAAUAAAAACGCUUAUUGCUCCACGUUUGCC-------------- .......((...(((...((((((((......))))))))..)))...)).-------------- ( -9.30, z-score = -0.65, R) >droYak2.chr2L 16226432 51 - 22324452 AAAAUAUUCCCUUGUAUUGGCAAUAAAAACGCUUAUUGCUCAACGUUUCCC-------------- ................((((((((((......))))))).)))........-------------- ( -7.60, z-score = -2.01, R) >droEre2.scaffold_4929 15727053 51 + 26641161 UAAAUAUUCCCUUGUAUAGGCAAUAAAAACGCUUAUUGCGCAAUGUUUGCC-------------- ..................(((((......(((.....)))......)))))-------------- ( -9.40, z-score = -1.02, R) >droAna3.scaffold_12916 8395923 50 + 16180835 AAAAUAUUCCAUCGGAUAGGUAAUAAAAACGAUUAUUGCUUAGCGUUUCC--------------- ............((..((((((((((......)))))))))).)).....--------------- ( -8.10, z-score = -1.25, R) >droPer1.super_5 4791956 65 + 6813705 AAAAUAUUCCACUGGAUGGGUAAUAAAAACGCUUAUUGCUGAAUGCUCAGGGCUCUCUCUAUCUC .............(((((((((((((......))))))).((..((.....))..)).)))))). ( -11.50, z-score = -1.02, R) >dp4.chr4_group5 293029 65 + 2436548 AAAAUAUUCCACUGGAUGGGUAAUAAAAACGCUUAUUGCUGAAUGCUCAGGGCUCUCUCUAUCUC .............(((((((((((((......))))))).((..((.....))..)).)))))). ( -11.50, z-score = -1.02, R) >droWil1.scaffold_180772 1948715 50 - 8906247 AAAAUAUUCCAUCAGAUGGGUAAUAAAAU-GCUUAUUGCUUAACGCUAAAC-------------- ..............(.((((((((((...-..)))))))))).).......-------------- ( -7.00, z-score = -1.15, R) >droMoj3.scaffold_6500 14515239 50 - 32352404 AAAAUAUGCC-UCAGAUGGGCAAUAAAAAAGCUUAUUGCUUAUUGCUUAUC-------------- ..........-...(((((((((((....(((.....))))))))))))))-------------- ( -13.40, z-score = -2.38, R) >consensus AAAAUAUUCCAUUGGAUAGGCAAUAAAAACGCUUAUUGCUCAACGUUUACC______________ ..................((((((((......))))))))......................... ( -5.91 = -5.78 + -0.14)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 21:22:08 2011