| Sequence ID | dm3.chr3R |
|---|---|
| Location | 4,955,974 – 4,956,060 |
| Length | 86 |
| Max. P | 0.558433 |
| Location | 4,955,974 – 4,956,060 |
|---|---|
| Length | 86 |
| Sequences | 7 |
| Columns | 88 |
| Reading direction | reverse |
| Mean pairwise identity | 81.58 |
| Shannon entropy | 0.35619 |
| G+C content | 0.27131 |
| Mean single sequence MFE | -11.14 |
| Consensus MFE | -8.24 |
| Energy contribution | -8.14 |
| Covariance contribution | -0.10 |
| Combinations/Pair | 1.12 |
| Mean z-score | -1.16 |
| Structure conservation index | 0.74 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.13 |
| SVM RNA-class probability | 0.558433 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 4955974 86 - 27905053 UGAGGUAAAAAUUUAUUUUUAAUUUGGAAGAAUAUUUUCACAG--UUUUUUCCACUCUACGCUUUUCUACUCGGACACAUGUUCAUGU .(((.((((((....))))))...((((((((...........--.))))))))...............)))((((....)))).... ( -12.80, z-score = -0.73, R) >droAna3.scaffold_13340 9115306 80 + 23697760 UGAGGUAAAAAUUUAUUUUUAAUUUGGAAGAAUAUUUUCACAA--UUUUUUCCACUCUACCCUCGCGAACACACACACAAUC------ .((((((((((....))))))...((((((((...........--.))))))))......))))..................------ ( -12.00, z-score = -2.55, R) >droEre2.scaffold_4770 1100376 80 + 17746568 UGAGGUAAAAAUUUAUUUUUAAUUUGGAAGAAUAUUUUCACAA--UUUUUUCCACUCUACUUUUACUCACACAUAUGCAUAC------ ((((.((((((....))))))...((((((((...........--.))))))))...........)))).............------ ( -10.00, z-score = -1.96, R) >droYak2.chr3R 9003193 82 - 28832112 UGAGGUAAAAAUUUAUUUUUAAUUUGGAAGAAUAUUUUCACAAUUUUUUUUCCACUCUACUGUUACUCAAACAUGUGCAUAC------ .(((.((((((....))))))...((((((((..............)))))))))))(((((((.....)))).))).....------ ( -10.64, z-score = -0.59, R) >droSec1.super_0 4195157 79 + 21120651 UGAGGUAAAAAUUUAUUUUUAAUUUGGAAGAAUAUUUUCACAA--UUUUUUCCACUCUACUA-UACUCACGCAUGUUCAUGU------ ((((.((((((....))))))...((((((((...........--.))))))))........-..)))).((((....))))------ ( -11.10, z-score = -1.26, R) >droSim1.chr3R 11157791 79 + 27517382 UGAGGUAAAAAUUUAUUUUUAAUUUGGAAGAAUAUUUUCACAA--UUUUUUCCACUCUACUA-UACUCACACAUGUUCAUGU------ ((((.((((((....))))))...((((((((...........--.))))))))........-..)))).((((....))))------ ( -10.80, z-score = -1.05, R) >droPer1.super_3 224101 81 + 7375914 UGAGGUAAAAAUUUAUUUUUAAUUUGGAAACAAAAUUUCACAG-CUUUUUUUCACUCUAUAAGUAUUCAUACGUGUGUGUGU------ .(((..(((((...........((((....)))).........-..)))))...)))..........(((((....))))).------ ( -10.65, z-score = 0.04, R) >consensus UGAGGUAAAAAUUUAUUUUUAAUUUGGAAGAAUAUUUUCACAA__UUUUUUCCACUCUACUAUUACUCACACAUGUGCAUGU______ .(((.((((((....))))))...((((((((..............)))))))))))............................... ( -8.24 = -8.14 + -0.10)
Generated by rnazCluster.pl (part of RNAz 1.0) on Wed Apr 20 00:00:00 2011