| Sequence ID | dm3.chr3R |
|---|---|
| Location | 4,707,906 – 4,707,972 |
| Length | 66 |
| Max. P | 0.915065 |
| Location | 4,707,906 – 4,707,972 |
|---|---|
| Length | 66 |
| Sequences | 9 |
| Columns | 68 |
| Reading direction | forward |
| Mean pairwise identity | 67.91 |
| Shannon entropy | 0.65787 |
| G+C content | 0.40910 |
| Mean single sequence MFE | -11.58 |
| Consensus MFE | -4.94 |
| Energy contribution | -5.06 |
| Covariance contribution | 0.11 |
| Combinations/Pair | 1.43 |
| Mean z-score | -1.47 |
| Structure conservation index | 0.43 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.24 |
| SVM RNA-class probability | 0.915065 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 4707906 66 + 27905053 GAAACGCACUGUAUUUGC-CACACACGUAUCCAGCGACUUGUCCAAAUCUAGGCAAGUCUUUUUCGG- ((((.((...((((.((.-....)).))))...))((((((((........))))))))..))))..- ( -14.80, z-score = -1.82, R) >droSim1.chr3R 10925984 66 - 27517382 GAAACGCACUGUAUUUGC-CACACACGUAUCCAGCGACUUGUCCAAAUCUAGGCAAGUCUUUUUCGG- ((((.((...((((.((.-....)).))))...))((((((((........))))))))..))))..- ( -14.80, z-score = -1.82, R) >droSec1.super_0 3966393 66 - 21120651 GAAACGCACUGUAUUUGC-CACACACGUAUCCAGCGACUUGACCAAAUCUAGGCAAGUCUUUUUCGG- ((((.((...((((.((.-....)).))))...))((((((.((.......))))))))..))))..- ( -13.90, z-score = -1.53, R) >droYak2.chr3R 8767697 66 + 28832112 GAAACGCACUGUAUUUGC-CAUACACUUAUCCAGCGACUUGUCCAAAUCUAGGCAAGUCUUUUUCGG- ((((.((...(((..((.-....))..)))...))((((((((........))))))))..))))..- ( -13.70, z-score = -1.95, R) >droEre2.scaffold_4770 866900 66 - 17746568 GAAACGCACUGUAUUUGC-CACACACUUAUCCAGCGACUUGUCCAAAUCUAGGCAAGUCUUUUUCGG- ((((.((...(((..((.-....))..)))...))((((((((........))))))))..))))..- ( -13.70, z-score = -1.86, R) >droAna3.scaffold_13340 3476989 54 + 23697760 AAAGCCUAUAACCUCU--------------AUACCUACUUUUCCAAAUCUGGACAAGUCUCUUUUUGG ...........((...--------------......((((.((((....)))).))))........)) ( -6.43, z-score = -0.92, R) >dp4.chr2 7736069 55 - 30794189 GAAACGUAUUGUACUU------------AGACAGAAACUUGUCUAAAUCUAGGCAGGUCUUUUUUGG- ................------------...((((((((((((((....)))))))))...))))).- ( -11.80, z-score = -1.49, R) >droPer1.super_3 1544862 55 - 7375914 GAAACGUAUUGUACUU------------AGACAGAAACUUGUCUAAAUCUAGGCAGGUCUUUUUUGG- ................------------...((((((((((((((....)))))))))...))))).- ( -11.80, z-score = -1.49, R) >droGri2.scaffold_15074 7495961 64 + 7742996 ---GACUAUUACAGUUAUGCAAUAACAGCUUUAACGAUUUAUUUACAUUCUUUCAAAUUUACUUCGG- ---..........((((.((.......))..))))................................- ( -3.30, z-score = -0.34, R) >consensus GAAACGCACUGUAUUUGC_CACACAC_UAUCCAGCGACUUGUCCAAAUCUAGGCAAGUCUUUUUCGG_ ....................................(((((((........))))))).......... ( -4.94 = -5.06 + 0.11)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:59:24 2011