| Sequence ID | dm3.chr3R |
|---|---|
| Location | 4,564,816 – 4,564,876 |
| Length | 60 |
| Max. P | 0.988381 |
| Location | 4,564,816 – 4,564,876 |
|---|---|
| Length | 60 |
| Sequences | 8 |
| Columns | 61 |
| Reading direction | reverse |
| Mean pairwise identity | 83.99 |
| Shannon entropy | 0.33081 |
| G+C content | 0.27313 |
| Mean single sequence MFE | -8.18 |
| Consensus MFE | -5.76 |
| Energy contribution | -5.98 |
| Covariance contribution | 0.22 |
| Combinations/Pair | 1.17 |
| Mean z-score | -2.66 |
| Structure conservation index | 0.70 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.32 |
| SVM RNA-class probability | 0.988381 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 4564816 60 - 27905053 GUCCCAUUUAAUUGCAUAAUUUAUUGAUAAUUAAAUGAAGCUCUAAAUUAAA-CCUCUUUG ((..((((((((((((........)).))))))))))..))...........-........ ( -8.80, z-score = -3.17, R) >droSim1.chr3R 10787682 61 + 27517382 GCCCCAUUUAAUUGCAUAAUUUAUUGAUAAUUAAAUGAAGCUCUAAAUUAAACUCUCUUUG ((..((((((((((((........)).))))))))))..)).................... ( -10.10, z-score = -3.50, R) >droSec1.super_0 3828711 61 + 21120651 GCCCCAUUUAAUUGCAUAAUUUAUUGAUAAUUAAAUGAAGCUCUAAAUUAAACUCUCUUUG ((..((((((((((((........)).))))))))))..)).................... ( -10.10, z-score = -3.50, R) >droYak2.chr3R 8625818 61 - 28832112 GCCCUGUUUAAUUGCAUAAUUUAUUGAUAAUUAAAUGAAGCUCUAAAUUAAACUCUCUUUG .....((((((((......((((((........))))))......))))))))........ ( -8.50, z-score = -2.47, R) >droEre2.scaffold_4770 724739 61 + 17746568 GCCCCGUUUAAUUGCAUAAUUUAUUGAUAAUUAAAUGAAGCUCUAAAUUAAACUCUGUUUG ((..((((((((((((........)).))))))))))..)).................... ( -9.70, z-score = -2.89, R) >droAna3.scaffold_13340 10974575 61 - 23697760 GUCCCAUUGAAGUGCAUAAUUUAUUGAAAAUUAAAUGAAGGCCCAAAUUAAAUUCUCUUUG ...........(.((....((((((........)))))).)).)................. ( -4.00, z-score = 0.86, R) >droPer1.super_6 2502762 57 - 6141320 GCCUCAUUUAAUUGCAUAAUUUAUUGAUAAUUAAAUGAAACCCU---CUCU-CUCUCUCUG ...(((((((((((((........)).)))))))))))......---....-......... ( -9.30, z-score = -6.12, R) >droGri2.scaffold_14906 10710450 58 + 14172833 GCCUCAUUUAAUUGCAUAAUUUAUUGAUAAUUAAAUAUGAAACU---CUUUGCUCCGUUUA .....(((((((((((........)).)))))))))........---.............. ( -4.90, z-score = -0.50, R) >consensus GCCCCAUUUAAUUGCAUAAUUUAUUGAUAAUUAAAUGAAGCUCUAAAUUAAACUCUCUUUG ....((((((((((((........)).))))))))))........................ ( -5.76 = -5.98 + 0.22)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:59:05 2011