| Sequence ID | dm3.chr3R |
|---|---|
| Location | 4,536,270 – 4,536,373 |
| Length | 103 |
| Max. P | 0.894321 |
| Location | 4,536,270 – 4,536,373 |
|---|---|
| Length | 103 |
| Sequences | 3 |
| Columns | 109 |
| Reading direction | forward |
| Mean pairwise identity | 71.96 |
| Shannon entropy | 0.39054 |
| G+C content | 0.46757 |
| Mean single sequence MFE | -28.13 |
| Consensus MFE | -15.47 |
| Energy contribution | -16.40 |
| Covariance contribution | 0.93 |
| Combinations/Pair | 1.24 |
| Mean z-score | -2.17 |
| Structure conservation index | 0.55 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.12 |
| SVM RNA-class probability | 0.894321 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 4536270 103 + 27905053 CUUUUUUGUGUUGGCCCCGACCGCUCGGUUUUGGCCUUCUU------CGUGGCCUCCCUGCCACGGAAUGGGUGGCAAUAAAAAUGUCUUUUUAUGUGUACGCUUGUCU ............((((..((((....))))..))))...((------((((((......))))))))(..((((((((((((((....))))))).))).))))..).. ( -32.80, z-score = -2.40, R) >droAna3.scaffold_13340 10950099 82 + 23697760 CUUUUUUGUGUUUGCCCAGACUCCGAGCCUU--GCCUCCUU-------------------------AUUUCGAGGCAAUAAAAAUGUCUUUUUAUGUGUACGUUUGUCU .................((((..((.((..(--(((((...-------------------------.....))))))(((((((....)))))))..)).))...)))) ( -15.20, z-score = -1.78, R) >droYak2.chr3R 8597299 109 + 28832112 CUUUUUUGUGUUGGCCCCAACUCCACGGUUUUGGCCUCCUUGGCCUCCGUGUUCUCCCUGGAACGGAAUGGGGGGCAAUAAAAAUGUCUUUUUAUGUGUACGCUUGUCU .......((((((.((((...(((((((....((((.....)))).))))(((((....))))))))...)))).))(((((((....)))))))....))))...... ( -36.40, z-score = -2.34, R) >consensus CUUUUUUGUGUUGGCCCCGACUCCACGGUUUUGGCCUCCUU______CGUG__CUCCCUG__ACGGAAUGGGAGGCAAUAAAAAUGUCUUUUUAUGUGUACGCUUGUCU ..(((((((((((....))))............(((((((......(((((((......)))))))...))))))).)))))))......................... (-15.47 = -16.40 + 0.93)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:59:03 2011