| Sequence ID | dm3.chr3R |
|---|---|
| Location | 4,020,637 – 4,020,727 |
| Length | 90 |
| Max. P | 0.795251 |
| Location | 4,020,637 – 4,020,727 |
|---|---|
| Length | 90 |
| Sequences | 5 |
| Columns | 103 |
| Reading direction | reverse |
| Mean pairwise identity | 70.06 |
| Shannon entropy | 0.50605 |
| G+C content | 0.56948 |
| Mean single sequence MFE | -18.43 |
| Consensus MFE | -10.06 |
| Energy contribution | -11.34 |
| Covariance contribution | 1.28 |
| Combinations/Pair | 1.12 |
| Mean z-score | -1.37 |
| Structure conservation index | 0.55 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.71 |
| SVM RNA-class probability | 0.795251 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 4020637 90 - 27905053 ACGGAAAAUGGCGCGUACAGUGUGCUU------CUGCCUCGGCUUCUGCUCCAUUCUCCUCAUCCCCAUUCCCC-------UCCUGCCUUUUUUGUCCUGGCA ..(((.(((((.((((((...))))..------..((....))....)).))))).)))...............-------....(((...........))). ( -20.60, z-score = -1.52, R) >droEre2.scaffold_4770 188987 69 + 17746568 ACGGAAAAUGGCGCGUACAGUGUGCUU------CUGCUUCUGCUUCUGCUCCCCCUCCUGCGUUUCGUCCUGCCA---------------------------- ..(((....((((((........((..------..((....))....)).........))))))...))).....---------------------------- ( -13.83, z-score = 0.08, R) >droYak2.chr3R 8094699 103 - 28832112 ACGGAAAAUGGCGCGUACAGUGUGCUUCUGGUGCUGCUUCUGACUUUGCUCCAUUCCCCUUCUCCCCAACCCCCACCACCUCCCUGCGUUUUUCGUCCUGCCA (((((((((((((((.....)))))...(((.((.............)).))).................................))))))))))....... ( -18.62, z-score = -0.17, R) >droSec1.super_0 3312595 83 + 21120651 ACGGAAAAUGGCGCGUACAGUGUGCU------------UCUGCUUCUGUUCCAUUCUCCUCCUCCCCAUCCCCC-------CUCUGC-CUUUUCGUCCUGGCA ..(((.(((((.....((((...((.------------...))..)))).))))).)))...............-------....((-(..........))). ( -18.10, z-score = -2.29, R) >droSim1.chr3R 10280594 89 + 27517382 ACGGAAAAUGGCGCGUACAGUGUGCUU------CUGCUUCUGCUUCUGCUCCAUUCUCCUCCUCCCCAUCCCCC-------CUCUGC-CUUUUCGUCCUGGCA ..(((.(((((.(((..(((...((..------..))..)))....))).))))).)))...............-------....((-(..........))). ( -21.00, z-score = -2.96, R) >consensus ACGGAAAAUGGCGCGUACAGUGUGCUU______CUGCUUCUGCUUCUGCUCCAUUCUCCUCCUCCCCAUCCCCC_______CCCUGC_CUUUUCGUCCUGGCA ..(((.(((((.(((..(((...((..........))..)))....))).))))).)))............................................ (-10.06 = -11.34 + 1.28)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:57:47 2011