| Sequence ID | dm3.chr3R |
|---|---|
| Location | 3,883,823 – 3,883,876 |
| Length | 53 |
| Max. P | 0.993584 |
| Location | 3,883,823 – 3,883,876 |
|---|---|
| Length | 53 |
| Sequences | 8 |
| Columns | 53 |
| Reading direction | forward |
| Mean pairwise identity | 92.32 |
| Shannon entropy | 0.15338 |
| G+C content | 0.34906 |
| Mean single sequence MFE | -13.87 |
| Consensus MFE | -13.00 |
| Energy contribution | -13.59 |
| Covariance contribution | 0.59 |
| Combinations/Pair | 1.14 |
| Mean z-score | -2.70 |
| Structure conservation index | 0.94 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.63 |
| SVM RNA-class probability | 0.993584 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 3883823 53 + 27905053 UGUUGUUAUUGUAAAUUAUGGCCGCAGCCGCAGAAAAAUAACAGCAAAUAAAA ((((((((((........((((....))))......))))))))))....... ( -13.34, z-score = -2.45, R) >droSec1.super_0 3187699 53 - 21120651 UGUUGUUAUUGUAAAUUAUGGCCGCAGCCGCAGAAAAAUAACAGCAAAUAAAA ((((((((((........((((....))))......))))))))))....... ( -13.34, z-score = -2.45, R) >droYak2.chr3R 7962525 53 + 28832112 UGUUGUUAUUGUAAAUUAUGGCCGCAGCCGCAGAAAAAUAACAGCAAAUAAAA ((((((((((........((((....))))......))))))))))....... ( -13.34, z-score = -2.45, R) >droEre2.scaffold_4770 57910 53 - 17746568 UGUUGUUAUUGUAAAUUAUGGCCGCAGCCGCAGAAAAAUAACAGCAAAUAAAA ((((((((((........((((....))))......))))))))))....... ( -13.34, z-score = -2.45, R) >droAna3.scaffold_13340 15155121 53 - 23697760 UGUUGUUAUUGUAAAUUAUGGCCGCAGCCGCAGAAAAAUAACAGCAAAUGAAA ((((((((((........((((....))))......))))))))))....... ( -13.34, z-score = -2.26, R) >droPer1.super_0 11594133 53 - 11822988 UGUUUUUAUUGUAAAUUAUGGCCGCAGCCGCAGAAAAAUAAAAGCAAAUAAAG ((((((((((........((((....))))......))))))))))....... ( -10.84, z-score = -1.81, R) >droMoj3.scaffold_6540 24678474 53 - 34148556 UGCUGUUACUGUAAAAUAUGGCUACGGCCGCAGCAAAAUAACAGCAAAUAAAA ((((((((((((.......(((....))))))).....))))))))....... ( -16.91, z-score = -3.52, R) >droGri2.scaffold_14906 6634245 53 - 14172833 CGCUGUUACUGUAAAAUAUGGCUACGGCCGCAGAAAAAUAACAGCAAAUAAAA .(((((((((((.......(((....))))))).....)))))))........ ( -16.51, z-score = -4.19, R) >consensus UGUUGUUAUUGUAAAUUAUGGCCGCAGCCGCAGAAAAAUAACAGCAAAUAAAA ((((((((((........((((....))))......))))))))))....... (-13.00 = -13.59 + 0.59)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:57:19 2011