| Sequence ID | dm3.chr3R |
|---|---|
| Location | 3,706,390 – 3,706,485 |
| Length | 95 |
| Max. P | 0.796279 |
| Location | 3,706,390 – 3,706,485 |
|---|---|
| Length | 95 |
| Sequences | 6 |
| Columns | 104 |
| Reading direction | forward |
| Mean pairwise identity | 61.83 |
| Shannon entropy | 0.69224 |
| G+C content | 0.41129 |
| Mean single sequence MFE | -12.19 |
| Consensus MFE | -5.45 |
| Energy contribution | -5.78 |
| Covariance contribution | 0.33 |
| Combinations/Pair | 1.00 |
| Mean z-score | -0.97 |
| Structure conservation index | 0.45 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.72 |
| SVM RNA-class probability | 0.796279 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 3706390 95 + 27905053 CUUCCGCU-UCCACC-UCCCCUGGCUUCGCAUCC-CCUUCAGGGCCACUUAAAUAUUUUACGCUUUUGUAUUGUUAAGCAAAAGUUUUUCCC--CAUCCC---- ........-......-..((((((..........-...)))))).................((((((((........)))))))).......--......---- ( -13.12, z-score = -0.67, R) >droSec1.super_6 3776285 96 + 4358794 CUUCCGCU-UCCCCCCUCCCCUGUCUUCGCAUCC-CCUUCAGGGCCGCUUAAAUAUUUUACGCUUUUGUAUUGUUAAGCAAAAGUUUUUCCC--CAUCCC---- .....(((-(........(((((...........-....)))))..((((((......((((....))))...))))))..)))).......--......---- ( -13.36, z-score = -1.95, R) >droWil1.scaffold_181089 7596479 99 + 12369635 UUUUAGCUGUUUCUGCUGCUGUGGCUACUUCCCCACCAUCAUGGCCACUUAAAUAUUUUACGCUUUUGUAUUGUUAAGCAAAAGUUUUUCCCUCCAUUC----- ....(((.((....)).)))(((((((..............))))))).............((((((((........))))))))..............----- ( -18.44, z-score = -1.91, R) >droVir3.scaffold_12855 3517831 93 - 10161210 -----------CCUGGCACGCCCUCAGUCCUUCUGCUCCAUAUGCCACUUAAAUAUUUUACGCUUUUGUAUUGUUAAGCAAAAGUUCUUUUAUUCUCGGUCGUU -----------(((((((......(((.....))).......)))))..............((((((((........))))))))............))..... ( -14.62, z-score = -1.09, R) >droMoj3.scaffold_6540 27129976 77 - 34148556 --------------CUUUCUCCAUUAGUUCCGCCGCUCCGUUUGCCACUUAAAUAUUUUACGCUUUUGUAUUGUUAAGCAAAAGUUCUUCU------------- --------------....................((.......))................((((((((........))))))))......------------- ( -7.30, z-score = -0.41, R) >droGri2.scaffold_14906 11354748 83 - 14172833 ----------------CAUUCGCUUCUACCACUUGCUCUAUAUGCCACUUAAAUAUUUUACGCUUUUAUAUUGUUAAGCUAAAGUUUUUUU-UACCCGCU---- ----------------.....((...........((.......)).....(((.((((((.((((..........)))))))))).)))..-.....)).---- ( -6.30, z-score = 0.20, R) >consensus ___________CC_C_UACUCUGUCUUCCCAUCCGCCCUCAAGGCCACUUAAAUAUUUUACGCUUUUGUAUUGUUAAGCAAAAGUUUUUCCC__CAUCC_____ .............................................................((((((((........))))))))................... ( -5.45 = -5.78 + 0.33)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:57:00 2011