| Sequence ID | dm3.chr3R |
|---|---|
| Location | 3,657,825 – 3,657,917 |
| Length | 92 |
| Max. P | 0.500000 |
| Location | 3,657,825 – 3,657,917 |
|---|---|
| Length | 92 |
| Sequences | 4 |
| Columns | 92 |
| Reading direction | reverse |
| Mean pairwise identity | 91.30 |
| Shannon entropy | 0.14181 |
| G+C content | 0.35422 |
| Mean single sequence MFE | -21.66 |
| Consensus MFE | -18.57 |
| Energy contribution | -17.95 |
| Covariance contribution | -0.62 |
| Combinations/Pair | 1.24 |
| Mean z-score | -1.41 |
| Structure conservation index | 0.86 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.02 |
| SVM RNA-class probability | 0.500000 |
| Prediction | OTHER |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 3657825 92 - 27905053 UGAUGUGCAUAAAAAUGCGCAUUAAUAAUUAUUAGGUGCAAAAAAAUGCAGCUUCUCCUUGUGGCACAUUAAAUCACAGCUUAAGGAUCUCA ((((((((((....)))))))))).........((.((((......)))).))..((((((.(((.............)))))))))..... ( -23.42, z-score = -2.07, R) >droYak2.chr3R_random 1155900 91 - 3277457 UCGUGUGCAUAAAAAUUCACAUUAAUAAUUAUUGGGGGCAAACAAAUGCUGCUUCUUCUUGUGGCACAUAAAAUAUCAGCUUAA-GACCUCA ..(((((.((....)).)))))..........((((((((......))).......(((((.(((.............))))))-))))))) ( -13.62, z-score = 0.44, R) >droSec1.super_6 3728604 92 - 4358794 UGAUGUGCAUAAAAAUGCGCAUUAAUAAUUAUUAGGUGCGAAAAAAUGCAGCUUCUUCUUGUGGCACAUUAAAUCGCAGCUUAAGGAUCUCA ((((((((((....)))))))))).......((((((((((...((((..(((.(.....).))).))))...))))).)))))........ ( -24.80, z-score = -2.01, R) >droSim1.chr3R 3694392 92 - 27517382 UGAUGUGCAUAAAAAUGCGCAUUAAUAAUUAUUAGGUGCGAAAAAAUGCAGCUUCUUCUUGUGGCACAUUAAAUCGCAGCUUAAGGAUCUCA ((((((((((....)))))))))).......((((((((((...((((..(((.(.....).))).))))...))))).)))))........ ( -24.80, z-score = -2.01, R) >consensus UGAUGUGCAUAAAAAUGCGCAUUAAUAAUUAUUAGGUGCAAAAAAAUGCAGCUUCUUCUUGUGGCACAUUAAAUCGCAGCUUAAGGAUCUCA ((((((((((....)))))))))).........((.((((......)))).))..((((((.(((.............)))))))))..... (-18.57 = -17.95 + -0.62)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:56:53 2011