Sequence ID | dm3.chr3R |
---|---|
Location | 3,476,976 – 3,477,047 |
Length | 71 |
Max. P | 0.500000 |
Location | 3,476,976 – 3,477,047 |
---|---|
Length | 71 |
Sequences | 4 |
Columns | 84 |
Reading direction | forward |
Mean pairwise identity | 63.16 |
Shannon entropy | 0.57108 |
G+C content | 0.29958 |
Mean single sequence MFE | -11.80 |
Consensus MFE | -6.70 |
Energy contribution | -8.21 |
Covariance contribution | 1.50 |
Combinations/Pair | 1.28 |
Mean z-score | -0.62 |
Structure conservation index | 0.57 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 0.01 |
SVM RNA-class probability | 0.500000 |
Prediction | OTHER |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 3476976 71 + 27905053 -------UUUGAAAAUGUUACAGAUUCCACGCUUAUUUAUGGCGAA------UAUAAUUAUAAUUAAAUGUGGAGGCAUGAGGC -------.........((..((..(((((((.(((.((((((....------.....)))))).))).)))))))...))..)) ( -12.60, z-score = -1.00, R) >droSec1.super_6 3568416 65 + 4358794 -------UUUGCAAAUUUUAGCACUUCCAUGCUUAUUUAUAGCGAA------UAUAAGUAUAAUUAAAUAUGGAAGCA------ -------..(((........)))((((((((.(((.(((((.(...------.....)))))).))).))))))))..------ ( -14.30, z-score = -1.71, R) >droYak2.chr3R_random 1085817 71 + 3277457 -----------CUAGACUUAGCGCUUAGAUAUUACUUUAAAGCGAACCACUUUAUAAGUAUUAUUAAAUAUUGAGGCAGAAA-- -----------.........((.((((((((.((((((((((.......))))).))))).))))......)))))).....-- ( -10.30, z-score = -0.58, R) >droEre2.scaffold_4770 3736675 82 + 17746568 CCCGCAAAUUGCAAUUCUAA--GAUUGGAUGUUAAUUUAUGGCGAACAACUUUAUAAGUAUAAUUAAAUAUUGAGGCAGAAGGA .((((.....))..((((..--..(((..(((((.....)))))..)))(((.(((..((....))..))).)))..)))))). ( -10.00, z-score = 0.79, R) >consensus _______UUUGCAAAUCUUAGCGAUUCCAUGCUAAUUUAUAGCGAA______UAUAAGUAUAAUUAAAUAUGGAGGCAGAAG__ ......................(((((((((((((.(((((.................))))).)))))))))))))....... ( -6.70 = -8.21 + 1.50)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:56:36 2011