| Sequence ID | dm3.chr3R |
|---|---|
| Location | 3,123,722 – 3,123,822 |
| Length | 100 |
| Max. P | 0.865537 |
| Location | 3,123,722 – 3,123,822 |
|---|---|
| Length | 100 |
| Sequences | 5 |
| Columns | 118 |
| Reading direction | reverse |
| Mean pairwise identity | 61.92 |
| Shannon entropy | 0.64293 |
| G+C content | 0.34230 |
| Mean single sequence MFE | -19.70 |
| Consensus MFE | -9.44 |
| Energy contribution | -9.64 |
| Covariance contribution | 0.20 |
| Combinations/Pair | 1.35 |
| Mean z-score | -1.15 |
| Structure conservation index | 0.48 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.97 |
| SVM RNA-class probability | 0.865537 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 3123722 100 - 27905053 -ACUUAAGAAA--AAACCUUUGAAAACAUCUCUAAAAGUUCAUA---UGCCCAAAAAUGUCCUUGCUGGAU-UGCAAAGCUGUCUUAACCUUUGCGAAGGGCAUUGU----------- -..........--...........................((.(---(((((.......(((.....)))(-(((((((.(......).)))))))).)))))))).----------- ( -20.40, z-score = -1.32, R) >droAna3.scaffold_13340 2913699 118 - 23697760 GAUUAAUAAAAAAAACCGUACAUUAUUUUUUAGAAAAAAUUAUGCAUAAUUAUAGUACUUAUAUACUGUAUCUAUGGAAACAUAUUAACCCACAGAAAGUGCAUGAAUAGGAGCUCGC ...............((........(((((....)))))((((((((...(((((((......)))))))..((((....))))..............))))))))...))....... ( -18.60, z-score = -1.41, R) >droYak2.chr3R 21618376 87 + 28832112 ----------------AAUUAAAAAUAAAAGCCAAAAGAUUAUA---AGCAAAGCAAUAUCCUUGGUGAAU-UGCAAAGCUGUCUUAACCUUUGCGAAGGGCAUUGC----------- ----------------............................---......(((((..(((.......(-(((((((.(......).)))))))))))..)))))----------- ( -15.11, z-score = 0.31, R) >droSec1.super_6 3216388 102 - 4358794 -AUUAAAAAAAUAAAACCUUGGAAAACAUCUCUAAAAGCUUAUA---UGCCCAAAAAUGUCCUUGCUGGAU-UGCAAAGCUGUCUUAACCUUUGCGAAGGGCAUUGC----------- -.................(((((.......)))))..((....(---(((((.......(((.....)))(-(((((((.(......).)))))))).)))))).))----------- ( -22.90, z-score = -2.05, R) >droSim1.chr3R 3169701 102 - 27517382 -AUUAAAAAAAUAAAACCUUGGAAAACAUCUGUAAAAGCUUAUA---UGCCCAAAAAUGUCCUUGCUGGAU-UGCAAAGCUGUCUUAACCUUUGCGAAGGGCAUUGC----------- -....................................((....(---(((((.......(((.....)))(-(((((((.(......).)))))))).)))))).))----------- ( -21.50, z-score = -1.29, R) >consensus _AUUAAAAAAA_AAAACCUUGGAAAACAUCUCUAAAAGAUUAUA___UGCCCAAAAAUGUCCUUGCUGGAU_UGCAAAGCUGUCUUAACCUUUGCGAAGGGCAUUGC___________ .......................................................(((((((((........(((((((.(......).))))))))))))))))............. ( -9.44 = -9.64 + 0.20)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:55:47 2011