| Sequence ID | dm3.chr3R |
|---|---|
| Location | 3,025,700 – 3,025,798 |
| Length | 98 |
| Max. P | 0.781126 |
| Location | 3,025,700 – 3,025,798 |
|---|---|
| Length | 98 |
| Sequences | 5 |
| Columns | 98 |
| Reading direction | forward |
| Mean pairwise identity | 94.08 |
| Shannon entropy | 0.10567 |
| G+C content | 0.34694 |
| Mean single sequence MFE | -16.36 |
| Consensus MFE | -14.50 |
| Energy contribution | -14.58 |
| Covariance contribution | 0.08 |
| Combinations/Pair | 1.11 |
| Mean z-score | -1.72 |
| Structure conservation index | 0.89 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.67 |
| SVM RNA-class probability | 0.781126 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 3025700 98 + 27905053 AUAAGCAACACUGUCAGCUUUUCGCUGAUACCCUUCAAAAUUAAUCACAUAAGCAGAAAAGUACGCUAUAUUUUUGCACCAGCCAAAAUGCAAUUUUA ....(((....(((((((.....)))))))......................(((((((.(((...))).)))))))...........)))....... ( -17.60, z-score = -1.86, R) >droEre2.scaffold_4770 3288393 98 + 17746568 AUAAGCAAUACCGUCAGCUUUUCGCUGUUACCCUUCAAAAUUAAUCACAUAAGCAGAAAAGUACGCUAUAUUUUUGCACCAGCCAAAAUGCAGUUUUA ....((.(((.(((..((((((((((.........................))).)))))))))).)))(((((.((....)).)))))))....... ( -15.11, z-score = -1.01, R) >droYak2.chr3R_random 785494 98 + 3277457 AUCGGUAACACCGUCAGUUUUUCGCUGUUAUCAUUUUAAAAUAAUCACAUAAGCAGAAAAGUACGUUAUAUUUUUGCACCAGCCAAAAUGCAAUUUUA ...(((((((.((.........)).)))))))....((((((..........(((((((.(((...))).)))))))....((......)).)))))) ( -15.10, z-score = -1.43, R) >droSec1.super_6 3117708 98 + 4358794 AUAAGCAACACCGUCAGCUUUUCGCUGAUACCCUUCAAAAUUAAUCACAUAAGCAGAAAAGUACGCUAUAUUUUUGCACCAGCCAAAAUGCAAUUUUA ....(((.....((((((.....)))))).......................(((((((.(((...))).)))))))...........)))....... ( -17.00, z-score = -2.15, R) >droSim1.chr3R 3067967 98 + 27517382 AUAAGCAACACCGUCAGCUUUUCGCUGAUACCCUUCAAAAUUAAUCACAUAAGCAGAAAAGUACGCUAUAUUUUUGCACCAGCCAAAAUGCAAUUUUA ....(((.....((((((.....)))))).......................(((((((.(((...))).)))))))...........)))....... ( -17.00, z-score = -2.15, R) >consensus AUAAGCAACACCGUCAGCUUUUCGCUGAUACCCUUCAAAAUUAAUCACAUAAGCAGAAAAGUACGCUAUAUUUUUGCACCAGCCAAAAUGCAAUUUUA ....(((.....((((((.....)))))).......................(((((((.(((...))).)))))))...........)))....... (-14.50 = -14.58 + 0.08)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:55:35 2011