| Sequence ID | dm3.chr3R |
|---|---|
| Location | 2,957,273 – 2,957,382 |
| Length | 109 |
| Max. P | 0.535607 |
| Location | 2,957,273 – 2,957,382 |
|---|---|
| Length | 109 |
| Sequences | 5 |
| Columns | 113 |
| Reading direction | forward |
| Mean pairwise identity | 66.86 |
| Shannon entropy | 0.55955 |
| G+C content | 0.30176 |
| Mean single sequence MFE | -16.92 |
| Consensus MFE | -7.52 |
| Energy contribution | -8.20 |
| Covariance contribution | 0.68 |
| Combinations/Pair | 1.25 |
| Mean z-score | -1.29 |
| Structure conservation index | 0.44 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.08 |
| SVM RNA-class probability | 0.535607 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 2957273 109 + 27905053 GCUGUACGUUGUACUAGAUUAUAUUAGCAGUCCGAAUAAAUUAAACUUUAAUCGGGCUAAAAAAUUAAGCGAAUACGA----UUAUAGAAAUUAAUCGUCAUUCUUCGUUCGU (((((((...))))..............(((((((.((((......)))).))))))).........)))((((((((----(((.......))))))).))))......... ( -24.20, z-score = -2.24, R) >droEre2.scaffold_4770 3220069 107 + 17746568 GCUG-GUUUAGAAAUAGAACAUAUCAGCAGUCCGAAUAAUUUAAACUAAAAUCGGGCUAUAUAAAUAAACGCAUACAUUUCGAUAAAGCAAUUGGCGUUGGUCUUACU----- ((((-(((((....))).....))))))(((((((................))))))).........(((((....(((.(......).)))..))))).........----- ( -19.09, z-score = -0.95, R) >droYak2.chr3R 21438507 85 - 28832112 GCUGUACUUUGAAAUAGAUCAUAUUAGCAGUCUGAAUAAA---------AAUCGGGCUAAACAAUAAAACGAAUACAUAA--AUAAAACAAUUGCU----------------- ((((.....(((......)))...))))(((((((.....---------..)))))))......................--..............----------------- ( -11.20, z-score = -1.23, R) >droSec1.super_6 3047208 89 + 4358794 GCUGUACGUUGUACUAGAUCAUAUUAGCAGUCUGAAUAAAUUAAACCUUAAUCGGGCUAAGAAAUUAAGUGAUUACGA----UUAUAGAAAUU-------------------- .(((((.((((((....(((((.......((((((.(((........))).))))))(((....))).))))))))))----)))))).....-------------------- ( -16.60, z-score = -1.28, R) >droSim1.chr3R 2998059 91 + 27517382 ACAGUUCGUUGUACUAGAUCAUAUUAGCAGUUCGAAUAAAUUAAACCUUAAUCGGGCUAAAAAAUUAAGCGAAUAUAGAU--UUAUAGAAAUU-------------------- ........((.((.(((((((((((.(((((((((.(((........))).)))))))..........)).))))).)))--))))).))...-------------------- ( -13.50, z-score = -0.76, R) >consensus GCUGUACGUUGUACUAGAUCAUAUUAGCAGUCCGAAUAAAUUAAACCUUAAUCGGGCUAAAAAAUUAAGCGAAUACAA____UUAUAGAAAUU____________________ ((((.....((........))...))))(((((((.(((........))).)))))))....................................................... ( -7.52 = -8.20 + 0.68)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:55:25 2011