| Sequence ID | dm3.chr3R |
|---|---|
| Location | 2,876,745 – 2,876,833 |
| Length | 88 |
| Max. P | 0.725884 |
| Location | 2,876,745 – 2,876,833 |
|---|---|
| Length | 88 |
| Sequences | 4 |
| Columns | 103 |
| Reading direction | reverse |
| Mean pairwise identity | 67.78 |
| Shannon entropy | 0.49853 |
| G+C content | 0.32027 |
| Mean single sequence MFE | -15.15 |
| Consensus MFE | -9.49 |
| Energy contribution | -9.55 |
| Covariance contribution | 0.06 |
| Combinations/Pair | 1.11 |
| Mean z-score | -1.02 |
| Structure conservation index | 0.63 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.51 |
| SVM RNA-class probability | 0.725884 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 2876745 88 - 27905053 ---------------UUUCAUACCAUAAUUCUUAAUAUGAGCAUAUAACCGAUUUGGAAUUUGACAUUACCCGAAUGUAGGGUAUUCAAGGUCUUUAGACCCG ---------------.......(((.((((....((((....))))....)))))))...((((...(((((.......))))).))))((((....)))).. ( -16.70, z-score = -1.00, R) >droSim1.chr3R 2919627 88 - 27517382 ---------------UUCCAUACCACAGUUUUUAACAUAUGCAUAUAACAGAUUUGAAAUUGGUUAUUACCCUAAUGUAGGGUAUUCAAGGUCUUUAGACCCA ---------------..........(((((((.......((.......)).....))))))).....(((((((...))))))).....((((....)))).. ( -15.60, z-score = -0.56, R) >droYak2.chr3R_random 728621 99 - 3277457 UUAAAAUAUGAUCGUUUCCAUACUAUAAUUUAAAACA----AAUUUAACCGAUUCUAAAUUUUAAGUUACCCUAAUAAAGCGUAUUCAAGGUCUUCAGACCGA ........(((.(((((........(((((((((...----.(((((........))))))))))))))........)))))...))).((((....)))).. ( -13.69, z-score = -1.70, R) >droEre2.scaffold_4770 3129617 98 - 17746568 UUCAAAUAUGAUCCUUUCCCUACCAUAAUUUAAAUCA----AAUUUAAACGACUCGGAAUUCGAAAUUACCUU-ACAUAGGGUAUUCAAGGUCUUCAGACCAA ........(((......(((((......(((((((..----.)))))))(((........)))..........-...)))))...))).((((....)))).. ( -14.60, z-score = -0.80, R) >consensus _______________UUCCAUACCAUAAUUUAAAACA____AAUAUAACCGAUUCGAAAUUUGAAAUUACCCUAAUAUAGGGUAUUCAAGGUCUUCAGACCCA ...................................................................(((((.......))))).....((((....)))).. ( -9.49 = -9.55 + 0.06)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:55:16 2011