| Sequence ID | dm3.chr3R |
|---|---|
| Location | 1,889,626 – 1,889,677 |
| Length | 51 |
| Max. P | 0.550447 |
| Location | 1,889,626 – 1,889,677 |
|---|---|
| Length | 51 |
| Sequences | 3 |
| Columns | 51 |
| Reading direction | reverse |
| Mean pairwise identity | 89.47 |
| Shannon entropy | 0.14405 |
| G+C content | 0.28471 |
| Mean single sequence MFE | -5.43 |
| Consensus MFE | -5.32 |
| Energy contribution | -5.10 |
| Covariance contribution | -0.22 |
| Combinations/Pair | 1.17 |
| Mean z-score | -0.73 |
| Structure conservation index | 0.98 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.11 |
| SVM RNA-class probability | 0.550447 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 1889626 51 - 27905053 UAUAUUUCUGAAUCAAAUUCCUUGAAAAGUGUACACAAAUACGUAGUGUAC ....((((.((((...))))...))))...((((((.........)))))) ( -6.10, z-score = -0.47, R) >droSec1.super_6 1991074 50 - 4358794 UACAAAU-UAAAUCAAAUUCCUUAAAAAGUGUGCACAAAUACGCAGUGUAC .......-......................((((((.........)))))) ( -5.10, z-score = -0.67, R) >droSim1.chr3R 1916679 50 - 27517382 UACAAAU-UAAAUCAAAUUCCUUAAAAAGUGUACACAAAUACGUAGUGUAC .......-......................((((((.........)))))) ( -5.10, z-score = -1.06, R) >consensus UACAAAU_UAAAUCAAAUUCCUUAAAAAGUGUACACAAAUACGUAGUGUAC ..............................((((((.........)))))) ( -5.32 = -5.10 + -0.22)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:52:51 2011