| Sequence ID | dm3.chr3R |
|---|---|
| Location | 1,799,059 – 1,799,121 |
| Length | 62 |
| Max. P | 0.925651 |
| Location | 1,799,059 – 1,799,121 |
|---|---|
| Length | 62 |
| Sequences | 4 |
| Columns | 62 |
| Reading direction | forward |
| Mean pairwise identity | 91.13 |
| Shannon entropy | 0.14394 |
| G+C content | 0.55878 |
| Mean single sequence MFE | -16.20 |
| Consensus MFE | -12.25 |
| Energy contribution | -13.63 |
| Covariance contribution | 1.38 |
| Combinations/Pair | 1.07 |
| Mean z-score | -2.64 |
| Structure conservation index | 0.76 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.32 |
| SVM RNA-class probability | 0.925651 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 1799059 62 + 27905053 UCCGUUUCGCUCCUUUCCGCUGCUGCGUGGUCCUUCCUGGUCCAUCCGUGAAACAGCAAAAA ...(((((((.......(((....)))(((.((.....)).)))...)))))))........ ( -18.40, z-score = -3.58, R) >droEre2.scaffold_4770 2064199 62 + 17746568 UCCGUUUCGCUCCUUUCCGCUGCUGCGUGGUCCUUCCUGGUCCGUCCGUGAAACAGCAAAAA ...(((((((.......(((....))).((.((.....)).))....)))))))........ ( -17.70, z-score = -2.87, R) >droSec1.super_6 1908701 52 + 4358794 UCCGUUUCGCUCCUUUCCGCUGCUGC----------CUGGUCCGUCCGUGAAACAGCAAAAA ...(((((((........((....))----------..((.....)))))))))........ ( -11.00, z-score = -1.26, R) >droSim1.chr3R 1835770 62 + 27517382 UCCGUUUCGCUCCUUUCCGCUGCUGCGUGGUCCUUCCUGGUCCGUCCGUGAAACAGCAAAAA ...(((((((.......(((....))).((.((.....)).))....)))))))........ ( -17.70, z-score = -2.87, R) >consensus UCCGUUUCGCUCCUUUCCGCUGCUGCGUGGUCCUUCCUGGUCCGUCCGUGAAACAGCAAAAA ...(((((((.......(((....)))(((.((.....)).)))...)))))))........ (-12.25 = -13.63 + 1.38)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:52:37 2011