| Sequence ID | dm3.chr3R |
|---|---|
| Location | 1,359,337 – 1,359,387 |
| Length | 50 |
| Max. P | 0.999067 |
| Location | 1,359,337 – 1,359,387 |
|---|---|
| Length | 50 |
| Sequences | 3 |
| Columns | 50 |
| Reading direction | forward |
| Mean pairwise identity | 92.00 |
| Shannon entropy | 0.11020 |
| G+C content | 0.27333 |
| Mean single sequence MFE | -8.40 |
| Consensus MFE | -8.40 |
| Energy contribution | -8.40 |
| Covariance contribution | 0.00 |
| Combinations/Pair | 1.00 |
| Mean z-score | -4.40 |
| Structure conservation index | 1.00 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 3.63 |
| SVM RNA-class probability | 0.999067 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 1359337 50 + 27905053 CUUUUAAUUCACUUUAGACUGGAAACAGAUCUACAUCAAAAACAAAAAAA ..............(((((((....))).))))................. ( -8.40, z-score = -3.64, R) >droSim1.chr3R 1394204 50 + 27517382 CUUUUAAUUCACAUUAGACUGGAAACAGAUCUACAAACAAAACAAAAACU ..............(((((((....))).))))................. ( -8.40, z-score = -5.03, R) >droSec1.super_6 1473558 50 + 4358794 CUUUUAAUUCACUUUAGACUGGAAACAGAUCUACAAACAAAACAAAAACU ..............(((((((....))).))))................. ( -8.40, z-score = -4.53, R) >consensus CUUUUAAUUCACUUUAGACUGGAAACAGAUCUACAAACAAAACAAAAACU ..............(((((((....))).))))................. ( -8.40 = -8.40 + 0.00)
| Location | 1,359,337 – 1,359,387 |
|---|---|
| Length | 50 |
| Sequences | 3 |
| Columns | 50 |
| Reading direction | reverse |
| Mean pairwise identity | 92.00 |
| Shannon entropy | 0.11020 |
| G+C content | 0.27333 |
| Mean single sequence MFE | -7.53 |
| Consensus MFE | -5.80 |
| Energy contribution | -5.80 |
| Covariance contribution | -0.00 |
| Combinations/Pair | 1.00 |
| Mean z-score | -2.26 |
| Structure conservation index | 0.77 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.51 |
| SVM RNA-class probability | 0.722418 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 1359337 50 - 27905053 UUUUUUUGUUUUUGAUGUAGAUCUGUUUCCAGUCUAAAGUGAAUUAAAAG .........(((((((.((((.(((....)))))))......))))))). ( -6.50, z-score = -1.09, R) >droSim1.chr3R 1394204 50 - 27517382 AGUUUUUGUUUUGUUUGUAGAUCUGUUUCCAGUCUAAUGUGAAUUAAAAG ...(((((.((..(...((((.(((....)))))))..)..)).))))). ( -7.80, z-score = -2.77, R) >droSec1.super_6 1473558 50 - 4358794 AGUUUUUGUUUUGUUUGUAGAUCUGUUUCCAGUCUAAAGUGAAUUAAAAG ...(((((.((..(((.((((.(((....))))))))))..)).))))). ( -8.30, z-score = -2.91, R) >consensus AGUUUUUGUUUUGUUUGUAGAUCUGUUUCCAGUCUAAAGUGAAUUAAAAG ..((((.((((......((((.(((....)))))))....)))).)))). ( -5.80 = -5.80 + -0.00)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:51:30 2011