| Sequence ID | dm3.chr3R |
|---|---|
| Location | 1,081,840 – 1,081,909 |
| Length | 69 |
| Max. P | 0.563007 |
| Location | 1,081,840 – 1,081,909 |
|---|---|
| Length | 69 |
| Sequences | 4 |
| Columns | 69 |
| Reading direction | forward |
| Mean pairwise identity | 66.91 |
| Shannon entropy | 0.54551 |
| G+C content | 0.32460 |
| Mean single sequence MFE | -9.98 |
| Consensus MFE | -5.48 |
| Energy contribution | -4.54 |
| Covariance contribution | -0.94 |
| Combinations/Pair | 1.56 |
| Mean z-score | -0.89 |
| Structure conservation index | 0.55 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.14 |
| SVM RNA-class probability | 0.563007 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 1081840 69 + 27905053 AUCUCAGAAAGACACCCAAAUUAUUUUUGGGAACAGACGUUAAGUAAGCCUUUUCUUUGAUAACCUUCU (((..((((((...((((((.....))))))(((....))).........))))))..)))........ ( -12.40, z-score = -1.29, R) >droYak2.chr3R 1455126 52 + 28832112 AACUUGGAAAGA--CUGAAGUUAUUUUUAAGUAAGAAUUUUUUGAUAACCAUUG--------------- .(((((((((((--(....))).)))))))))......................--------------- ( -6.70, z-score = -0.66, R) >droSec1.super_6 1204947 69 + 4358794 AUCUCAGAAAGACACACGAAUUAUUUUUGGGAACAGACGUUAAGUAAGCCUUUUCUUUGAUAACCUCCU .(((((((((.............)))))))))...((.((((...(((......)))...)))).)).. ( -8.82, z-score = 0.34, R) >droSim1.chr3R 1107606 68 + 27517382 AUCUUAGAAAGACACGCCAAUAAUUUUUGGAAACAGACGUUAAGUA-GCAUUUUCUUUGAUAACCUCCU (((..((((((....((...((((.((((....)))).))))....-)).))))))..)))........ ( -12.00, z-score = -1.96, R) >consensus AUCUCAGAAAGACACACAAAUUAUUUUUGGGAACAGACGUUAAGUAAGCCUUUUCUUUGAUAACCUCCU .(((((((((.............)))))))))..................................... ( -5.48 = -4.54 + -0.94)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:51:00 2011