| Sequence ID | dm3.chr3R |
|---|---|
| Location | 903,483 – 903,546 |
| Length | 63 |
| Max. P | 0.988850 |
| Location | 903,483 – 903,546 |
|---|---|
| Length | 63 |
| Sequences | 4 |
| Columns | 63 |
| Reading direction | forward |
| Mean pairwise identity | 98.41 |
| Shannon entropy | 0.02575 |
| G+C content | 0.25397 |
| Mean single sequence MFE | -8.45 |
| Consensus MFE | -8.07 |
| Energy contribution | -8.07 |
| Covariance contribution | 0.00 |
| Combinations/Pair | 1.00 |
| Mean z-score | -1.50 |
| Structure conservation index | 0.96 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.70 |
| SVM RNA-class probability | 0.789773 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 903483 63 + 27905053 AAAACGCACUCGAGUUUAUUCAAGUUGCUCAAAUUAAUAUUCAAUUAAUUUGCAUAUUUAUUG .....(((((.(((....))).)).))).(((((((((.....)))))))))........... ( -8.70, z-score = -1.59, R) >droEre2.scaffold_4770 1176823 63 + 17746568 AAAACGCUCUCGAGUUUAUUCAAGUUGCUCAAAUUAAUAUUCAAUUAAUUUGCAUUUUUAUUG .....((....((((...........))))((((((((.....)))))))))).......... ( -7.70, z-score = -1.22, R) >droSec1.super_6 1027053 63 + 4358794 AAAACGCACUCGAGUUUAUUCAAGUUGCUCAAAUUAAUAUUCAAUUAAUUUGCAUUUUUAUUG .....(((((.(((....))).)).))).(((((((((.....)))))))))........... ( -8.70, z-score = -1.59, R) >droSim1.chr3R 925621 63 + 27517382 AAAACGCACUCGAGUUUAUUCAAGUUGCUCAAAUUAAUAUUCAAUUAAUUUGCAUUUUUAUUG .....(((((.(((....))).)).))).(((((((((.....)))))))))........... ( -8.70, z-score = -1.59, R) >consensus AAAACGCACUCGAGUUUAUUCAAGUUGCUCAAAUUAAUAUUCAAUUAAUUUGCAUUUUUAUUG .....((....((((...........))))((((((((.....)))))))))).......... ( -8.07 = -8.07 + 0.00)
| Location | 903,483 – 903,546 |
|---|---|
| Length | 63 |
| Sequences | 4 |
| Columns | 63 |
| Reading direction | reverse |
| Mean pairwise identity | 98.41 |
| Shannon entropy | 0.02575 |
| G+C content | 0.25397 |
| Mean single sequence MFE | -13.52 |
| Consensus MFE | -12.48 |
| Energy contribution | -12.72 |
| Covariance contribution | 0.25 |
| Combinations/Pair | 1.00 |
| Mean z-score | -3.02 |
| Structure conservation index | 0.92 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.34 |
| SVM RNA-class probability | 0.988850 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3R 903483 63 - 27905053 CAAUAAAUAUGCAAAUUAAUUGAAUAUUAAUUUGAGCAACUUGAAUAAACUCGAGUGCGUUUU ...........(((((((((.....))))))))).(((.(((((......))))))))..... ( -13.80, z-score = -3.00, R) >droEre2.scaffold_4770 1176823 63 - 17746568 CAAUAAAAAUGCAAAUUAAUUGAAUAUUAAUUUGAGCAACUUGAAUAAACUCGAGAGCGUUUU .....(((((((((((((((.....))))))))......(((((......))))).))))))) ( -12.70, z-score = -2.91, R) >droSec1.super_6 1027053 63 - 4358794 CAAUAAAAAUGCAAAUUAAUUGAAUAUUAAUUUGAGCAACUUGAAUAAACUCGAGUGCGUUUU ...........(((((((((.....))))))))).(((.(((((......))))))))..... ( -13.80, z-score = -3.09, R) >droSim1.chr3R 925621 63 - 27517382 CAAUAAAAAUGCAAAUUAAUUGAAUAUUAAUUUGAGCAACUUGAAUAAACUCGAGUGCGUUUU ...........(((((((((.....))))))))).(((.(((((......))))))))..... ( -13.80, z-score = -3.09, R) >consensus CAAUAAAAAUGCAAAUUAAUUGAAUAUUAAUUUGAGCAACUUGAAUAAACUCGAGUGCGUUUU ...........(((((((((.....))))))))).(((.(((((......))))))))..... (-12.48 = -12.72 + 0.25)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:50:37 2011