| Sequence ID | dm3.chr3RHet |
|---|---|
| Location | 1,836,210 – 1,836,300 |
| Length | 90 |
| Max. P | 0.500000 |
| Location | 1,836,210 – 1,836,300 |
|---|---|
| Length | 90 |
| Sequences | 5 |
| Columns | 90 |
| Reading direction | forward |
| Mean pairwise identity | 56.68 |
| Shannon entropy | 0.82497 |
| G+C content | 0.35010 |
| Mean single sequence MFE | -16.10 |
| Consensus MFE | -6.32 |
| Energy contribution | -5.28 |
| Covariance contribution | -1.04 |
| Combinations/Pair | 1.56 |
| Mean z-score | -0.55 |
| Structure conservation index | 0.39 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.01 |
| SVM RNA-class probability | 0.500000 |
| Prediction | OTHER |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3RHet 1836210 90 + 2517507 UUUAAUUCGUUUGUUUAUUCUUUUUCCGUUUGUUUGCAUUCUAGAGAUCGUAGUUAUUUAGAGUCGUGCGACGUCGAUAGUUAUCGAUGU .............................((((.((.((((((((...........)))))))))).))))(((((((....))))))). ( -15.00, z-score = -0.04, R) >droSec1.super_61 63982 85 + 189864 AUUAUUUCGUUUGUUAACC-UUUUUCUGCAUAUAUGCUUGUUAGAGAUCGUA----CGUAGAGUCCUGAGACGUCGAUAGUUAUCGAUGU ..................(-((.((((((.(((...(((....)))...)))----.))))))....)))((((((((....)))))))) ( -16.80, z-score = -0.43, R) >droYak2.chr2h_random 1937353 86 - 3774259 -AUUAAUGCACAGUUUACCAUUUUUUUU--U-UUUACUUAUUAGAGAUGGUAGUCCAUUAGAGUUGUAAGACGUCGAUAAUUAUCGAUAU -.((((((.((....((((((((((..(--.-.......)..)))))))))))).)))))).(((....)))((((((....)))))).. ( -17.50, z-score = -2.84, R) >droEre2.scaffold_4929 2821094 76 - 26641161 -------------UUUAAUGUUUUGUUUACU-UUUGAUAGUUAAAGAUCGUAGGUGCUUUGUGUUGUGAGACGUCAAAAGUUACUGAUGC -------------...........((..(((-((((((...(((((((.....)).))))).(((....)))))))))))).))...... ( -11.20, z-score = 0.35, R) >droAna3.scaffold_13417 6140799 90 + 6960332 UUCUUUUUGUUUGUUCCUCGCUUGCUUGAGUUUGGUCUUGAUAGCGGUUGUAGCGAUUCAGAGUCCGAAGACUUGGUUGUUCAGCUAAGU ......(((((....((..((((....))))..))....))))).(((((.((((((...(((((....))))).))))))))))).... ( -20.00, z-score = 0.23, R) >consensus _UUAAUUCGUUUGUUUACCGUUUUUUUGA_U_UUUGCUUGUUAGAGAUCGUAGUUACUUAGAGUCGUGAGACGUCGAUAGUUAUCGAUGU ..............................................................(((....)))((((((....)))))).. ( -6.32 = -5.28 + -1.04)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:48:52 2011