| Sequence ID | dm3.chr3RHet |
|---|---|
| Location | 1,314,911 – 1,314,961 |
| Length | 50 |
| Max. P | 0.644110 |
| Location | 1,314,911 – 1,314,961 |
|---|---|
| Length | 50 |
| Sequences | 3 |
| Columns | 51 |
| Reading direction | reverse |
| Mean pairwise identity | 59.87 |
| Shannon entropy | 0.56952 |
| G+C content | 0.33163 |
| Mean single sequence MFE | -6.73 |
| Consensus MFE | -2.11 |
| Energy contribution | -2.33 |
| Covariance contribution | 0.22 |
| Combinations/Pair | 1.14 |
| Mean z-score | -2.08 |
| Structure conservation index | 0.31 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.32 |
| SVM RNA-class probability | 0.644110 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3RHet 1314911 50 - 2517507 AACCAUCCCCUAA-AAGUAACGUUACAAGUUACUUCGUGUUAUACAUUCAC .............-(((((((.......)))))))................ ( -5.80, z-score = -1.65, R) >droPer1.super_70 242479 51 - 290266 CAUUGCAUUUAAAUAAAUAAGACAGAAAGUUUUUUUGAGCGAUGUAUUAAC ((((((((((....))))....(((((.....))))).))))))....... ( -6.70, z-score = -1.15, R) >droYak2.chrU 2959038 50 - 28119190 AACCAUCCACAUA-AAGUAACCUUACAAGUUACUUAGCGUGAUCCAUUCAC .......(((...-(((((((.......)))))))...))).......... ( -7.70, z-score = -3.45, R) >consensus AACCAUCCACAAA_AAGUAACAUUACAAGUUACUUAGAGUGAUACAUUCAC ..............(((((((.......)))))))................ ( -2.11 = -2.33 + 0.22)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:48:24 2011