| Sequence ID | dm3.chr3L |
|---|---|
| Location | 24,512,628 – 24,512,686 |
| Length | 58 |
| Max. P | 0.545970 |
| Location | 24,512,628 – 24,512,686 |
|---|---|
| Length | 58 |
| Sequences | 5 |
| Columns | 60 |
| Reading direction | forward |
| Mean pairwise identity | 55.27 |
| Shannon entropy | 0.81624 |
| G+C content | 0.51402 |
| Mean single sequence MFE | -17.22 |
| Consensus MFE | -5.78 |
| Energy contribution | -6.98 |
| Covariance contribution | 1.20 |
| Combinations/Pair | 1.95 |
| Mean z-score | -0.91 |
| Structure conservation index | 0.34 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.11 |
| SVM RNA-class probability | 0.545970 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 24512628 58 + 24543557 UGGCUAUGUGAUAGAAUGGUGCAUACAAAGUGCGCUGGUUUUAAUGGCCGUACAAGUG-- .((((((....(((((((((((((.....))))))).)))))))))))).........-- ( -17.20, z-score = -1.67, R) >droAna3.scaffold_13260 1182346 60 + 2125536 UGGCGCUGUGAAAACGUUUGACACGCUAAGUAUGCUAGGUUCAUGGCCUCAGUUUCAGAU (((((.(((.((.....)).)))))))).(...(((((((.....)))).)))..).... ( -13.20, z-score = 0.26, R) >droPer1.super_163 65550 58 - 79481 UGCCUCUGCGAUAGCGUAGUGCACGUAAAAUGCGCUGGGCUUACGGGCCUCGUGGGCG-- .((((..(((((((((((.((....))...)))))))((((....)))))))))))).-- ( -22.60, z-score = -0.79, R) >droWil1.scaffold_181145 2678275 58 - 2682060 UGGUUGUGGGACAAUGCGGUUCACGUUAAGUGUGCAGGUUACACAGGCAGAAUCAAGG-- ((.(((((..((..((((...(((.....))))))).))..))))).)).........-- ( -15.10, z-score = -1.60, R) >droVir3.scaffold_12958 1256955 58 - 3547706 UGGCUGGGUGAUAAUGCCCUGCAUUAUAAAUGUGCGGGCUACACUGGUCUAGUGGGGG-- .(((..((((.....((((.((((.......))))))))))).)..))).........-- ( -18.00, z-score = -0.75, R) >consensus UGGCUCUGUGAUAACGUGGUGCACGCUAAGUGUGCUGGGUUCACGGGCCGAGUGAGGG__ .(((((.((((..((.((((((((.....)))))))).)))))))))))........... ( -5.78 = -6.98 + 1.20)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:47:22 2011