Sequence ID | dm3.chr3L |
---|---|
Location | 24,345,918 – 24,345,970 |
Length | 52 |
Max. P | 0.996108 |
Location | 24,345,918 – 24,345,970 |
---|---|
Length | 52 |
Sequences | 3 |
Columns | 52 |
Reading direction | forward |
Mean pairwise identity | 58.33 |
Shannon entropy | 0.57793 |
G+C content | 0.33949 |
Mean single sequence MFE | -13.50 |
Consensus MFE | -4.71 |
Energy contribution | -5.83 |
Covariance contribution | 1.12 |
Combinations/Pair | 1.40 |
Mean z-score | -3.21 |
Structure conservation index | 0.35 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 2.89 |
SVM RNA-class probability | 0.996108 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 24345918 52 + 24543557 AUGUUUGCUUACAUAAAUAAGCAAAUAAAUGAGCAAGGGGAAAACAAUAAUU .((((((((((......))))))))))......................... ( -9.30, z-score = -2.58, R) >droSec1.super_5 5744069 52 - 5866729 AUGUUUGCUUAUAUAAAUAAGCAAAUAAAUGAGCAAGGAGGAAACUAUGAUA .(((((((((((....)))))))))))...........((....))...... ( -13.10, z-score = -4.07, R) >droEre2.scaffold_4929 25837476 50 + 26641161 AUGUUUAUGUUCGCUGGUGGUCCAGCUGAAGGGCAUGGGCAACGAUAAAA-- .((((((((((((((((....)))))....))))))))))).........-- ( -18.10, z-score = -2.98, R) >consensus AUGUUUGCUUACAUAAAUAAGCAAAUAAAUGAGCAAGGGGAAAACUAUAAU_ ..((((((((((....)))))))))).......................... ( -4.71 = -5.83 + 1.12)
Location | 24,345,918 – 24,345,970 |
---|---|
Length | 52 |
Sequences | 3 |
Columns | 52 |
Reading direction | reverse |
Mean pairwise identity | 58.33 |
Shannon entropy | 0.57793 |
G+C content | 0.33949 |
Mean single sequence MFE | -8.73 |
Consensus MFE | -2.66 |
Energy contribution | -3.67 |
Covariance contribution | 1.00 |
Combinations/Pair | 1.38 |
Mean z-score | -2.55 |
Structure conservation index | 0.30 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 1.20 |
SVM RNA-class probability | 0.908505 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 24345918 52 - 24543557 AAUUAUUGUUUUCCCCUUGCUCAUUUAUUUGCUUAUUUAUGUAAGCAAACAU ...........................(((((((((....)))))))))... ( -8.50, z-score = -2.74, R) >droSec1.super_5 5744069 52 + 5866729 UAUCAUAGUUUCCUCCUUGCUCAUUUAUUUGCUUAUUUAUAUAAGCAAACAU ...........................(((((((((....)))))))))... ( -8.20, z-score = -2.99, R) >droEre2.scaffold_4929 25837476 50 - 26641161 --UUUUAUCGUUGCCCAUGCCCUUCAGCUGGACCACCAGCGAACAUAAACAU --.(((((.(((((....))......(((((....))))).))))))))... ( -9.50, z-score = -1.92, R) >consensus _AUUAUAGUUUUCCCCUUGCUCAUUUAUUUGCUUAUUUAUGUAAGCAAACAU ............................((((((((....)))))))).... ( -2.66 = -3.67 + 1.00)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:47:09 2011