| Sequence ID | dm3.chr3L |
|---|---|
| Location | 24,298,129 – 24,298,180 |
| Length | 51 |
| Max. P | 0.500000 |
| Location | 24,298,129 – 24,298,180 |
|---|---|
| Length | 51 |
| Sequences | 4 |
| Columns | 56 |
| Reading direction | reverse |
| Mean pairwise identity | 41.10 |
| Shannon entropy | 0.96276 |
| G+C content | 0.38664 |
| Mean single sequence MFE | -9.15 |
| Consensus MFE | -2.80 |
| Energy contribution | -2.05 |
| Covariance contribution | -0.75 |
| Combinations/Pair | 1.75 |
| Mean z-score | -0.77 |
| Structure conservation index | 0.31 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.02 |
| SVM RNA-class probability | 0.500000 |
| Prediction | OTHER |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 24298129 51 - 24543557 ----GUUACUC-UGCUUAUUUAAAAGCUGGGUGUCAUCAGAAUUGUUCUCAUCCAU ----.......-.((((......))))((((((....(......)....)))))). ( -8.80, z-score = -1.21, R) >droSim1.chrU 9853229 54 - 15797150 -UGAAUCGGUUCAGCUCUUCCGAGAGCGGUGGACUAGAGGUGUGAUUUUAUCCAU- -((((....))))(((((....))))).(((((.(((((......))))))))))- ( -13.20, z-score = -0.17, R) >droWil1.scaffold_181155 1545237 50 - 3442787 ----AUCAAUU-AGCUUAUUUCUAAUCGGAGGGUCAUAAUCACAAUUCUCUACUA- ----.......-...............(((((((..........)))))))....- ( -4.20, z-score = -0.72, R) >droMoj3.scaffold_6482 486989 51 + 2735782 AUCAAUCGGCUUAUUUCUAAGCUGAGAGUUAGCGGAAAGGU----UUUUAUCCAU- .....((((((((....))))))))........(((.....----.....)))..- ( -10.40, z-score = -0.98, R) >consensus ____AUCAGUU_AGCUCAUUUCAAAGCGGUGGGUCAUAAGUAU_AUUCUAUCCAA_ .............((((......))))............................. ( -2.80 = -2.05 + -0.75)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:47:05 2011