| Sequence ID | dm3.chr3L |
|---|---|
| Location | 23,013,993 – 23,014,048 |
| Length | 55 |
| Max. P | 0.756880 |
| Location | 23,013,993 – 23,014,048 |
|---|---|
| Length | 55 |
| Sequences | 6 |
| Columns | 62 |
| Reading direction | forward |
| Mean pairwise identity | 70.34 |
| Shannon entropy | 0.53955 |
| G+C content | 0.32237 |
| Mean single sequence MFE | -11.03 |
| Consensus MFE | -5.18 |
| Energy contribution | -5.19 |
| Covariance contribution | 0.00 |
| Combinations/Pair | 1.77 |
| Mean z-score | -1.49 |
| Structure conservation index | 0.47 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.60 |
| SVM RNA-class probability | 0.756880 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 23013993 55 + 24543557 UAAAAUAAGUUUGCCGAUUUAUAUGUGA------GGUACCUUUACAUAUUAAUUG-UUAUGC ..............(((((.((((((((------((...)))))))))).)))))-...... ( -10.90, z-score = -2.20, R) >droWil1.scaffold_180908 51207 58 + 366355 UAAAAACGAUUUGCCCACGCAUA-AUAACG-GCAAAUAUCUCU--AUGCUUGUUGUUGGGGG .............(((.....((-((((((-(((.........--.))).)))))))).))) ( -10.70, z-score = -0.36, R) >droEre2.scaffold_4784 22668197 56 + 25762168 UAAAAUAAGGUUGCCAAUUUAUAUGUGA------GAUACUUUUGCAUAUUUAUUGAUUAUGC ..............((((..(((((..(------((...)))..)))))..))))....... ( -9.60, z-score = -1.25, R) >droYak2.chrU 2545449 62 + 28119190 UAAAAUAAGGUUGCCGAUUCGUAUGUGAGAUACGAGUACUUUUGCAUACUUAUUGAUUGUGC ...((((((..(((..((((((((.....))))))))......)))..))))))........ ( -14.10, z-score = -2.00, R) >droSec1.super_41 38105 56 + 296808 UAAAAUAAGUUUGCCGAUUCAAGUGUGA------AGUACCUUCACACAUUAAUUGAUUGUGC ............((((((.(((((((((------((...)))))))).....))))))).)) ( -12.10, z-score = -2.32, R) >droSim1.chr3L 22287047 56 + 22553184 UAAAAUAAGUUUGGCGAUUCAAGUGUGA------AGUACCUUUACAUAUUAAUUGAUUGUGC .............(((((.(((((((((------((...)))))))).....)))))))).. ( -8.80, z-score = -0.85, R) >consensus UAAAAUAAGUUUGCCGAUUCAUAUGUGA______AGUACCUUUACAUAUUAAUUGAUUGUGC ..............(((((.((((((((.............)))))))).)))))....... ( -5.18 = -5.19 + 0.00)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:46:05 2011