Sequence ID | dm3.chr3L |
---|---|
Location | 22,395,697 – 22,395,795 |
Length | 98 |
Max. P | 0.830224 |
Location | 22,395,697 – 22,395,795 |
---|---|
Length | 98 |
Sequences | 5 |
Columns | 98 |
Reading direction | forward |
Mean pairwise identity | 77.03 |
Shannon entropy | 0.41505 |
G+C content | 0.40112 |
Mean single sequence MFE | -19.86 |
Consensus MFE | -13.85 |
Energy contribution | -14.57 |
Covariance contribution | 0.72 |
Combinations/Pair | 1.40 |
Mean z-score | -1.38 |
Structure conservation index | 0.70 |
Background model | dinucleotide |
Decision model | sequence based alignment quality |
SVM decision value | 0.83 |
SVM RNA-class probability | 0.830224 |
Prediction | RNA |
WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 22395697 98 + 24543557 GGCAGGGUCAUAAACUGGCUUUGAAUACAACAAACGGGGAAUCAAACAGAUCCCAUUUCCAGAUUCCCCAAAUACUAAGUCGUCAGCAUUCAUUUUUU ((((((((((.....))))))).............((((((((..................))))))))............))).............. ( -20.67, z-score = -1.35, R) >droSim1.chr3L 21706924 97 + 22553184 AGAAGGGCCAUAAACUGGCUUUGUAUACAACAAACGGGGAAUCAAACAGAUUCCAUUUCCAGGUUCCCCAAAUACUAACUCAGC-GCAUUCAUUUCUU .(((((((((.....))))))).............((((((((..................))))))))...............-....))....... ( -19.87, z-score = -1.20, R) >droSec1.super_11 2332271 91 + 2888827 AGAAGGGCCAUAAACUGGCUUUGAAUACAACUAUCGGGGAAUCAAACAGAUUCCAUUUCCAGGUUCCCCAAAUACCAAA---UCAGCAUUUCUU---- .(((((((((.....))))))).............((((((((..................))))))))..........---))..........---- ( -19.97, z-score = -1.17, R) >droYak2.chr3L 22824652 85 + 24197627 AGGACAGCCAUAAAUUGGUUUUAAAUACAACAAACGGGGA----------UUCCAUUUCUAGGUUCCCUAAACACUAAG---UCAGCAUUAUUUUCUU ..((((((((.....)))))...............(((((----------..((.......)).))))).........)---)).............. ( -16.00, z-score = -1.50, R) >droEre2.scaffold_4784 22065971 94 + 25762168 AGGACCGCCAUUAACUGCUUUGCAGUACAACAAACGGGGAAUUAAACAGAUUCCAGUUCUGGGUUCCCCAAACACUAAG---UCAGCAUU-UUUUCUU ..(((........(((((...))))).........(((((((....((((.......)))).))))))).........)---))......-....... ( -22.80, z-score = -1.70, R) >consensus AGAAGGGCCAUAAACUGGCUUUGAAUACAACAAACGGGGAAUCAAACAGAUUCCAUUUCCAGGUUCCCCAAAUACUAAG___UCAGCAUUCAUUUCUU ...(((((((.....))))))).............((((((((..................))))))))............................. (-13.85 = -14.57 + 0.72)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:44:41 2011