| Sequence ID | dm3.chr3L |
|---|---|
| Location | 21,967,267 – 21,967,382 |
| Length | 115 |
| Max. P | 0.955900 |
| Location | 21,967,267 – 21,967,382 |
|---|---|
| Length | 115 |
| Sequences | 5 |
| Columns | 120 |
| Reading direction | forward |
| Mean pairwise identity | 81.86 |
| Shannon entropy | 0.32517 |
| G+C content | 0.32058 |
| Mean single sequence MFE | -23.50 |
| Consensus MFE | -16.36 |
| Energy contribution | -17.32 |
| Covariance contribution | 0.96 |
| Combinations/Pair | 1.17 |
| Mean z-score | -2.25 |
| Structure conservation index | 0.70 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.62 |
| SVM RNA-class probability | 0.955900 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 21967267 115 + 24543557 UAAACUACAAUUACUAUUUACAUUGCAAGGCAUUUAAUGCUAAUAUCAUAACUAAAUGAGGAAGAGGGCUAAUACCGUUUACCUUAACUCAG-UACUGGGUUACCUCAACUUCUAC---- ............................(((((...)))))...............(((((.(((.((......)).)))....(((((((.-...))))))))))))........---- ( -18.80, z-score = -0.62, R) >droSim1.chr3L 21307533 109 + 22553184 UAAACCACAAUUACUAUUUACAUUGCAAGGCAAUUAAUGGUAAUAUUAUAACUAAACGAGGAAGAGGGCUAAUACCCUUUACUUCAACUCAA-UAAUGGGUUACCUAAAC---------- ..((((.(((((((((((...(((((...))))).))))))))).............((((.((((((......)))))).)))).......-...))))))........---------- ( -26.30, z-score = -4.09, R) >droSec1.super_11 1892829 109 + 2888827 UAAACCACAAUUACUAUUUACAUUGCAAGGCAAUUAAUGGUAAUAUUAUAACUAAACGAGGAAGAGGGCUAAUACCCUUUACUUCAACUCAA-UAAUGGGUUACCUAAAC---------- ..((((.(((((((((((...(((((...))))).))))))))).............((((.((((((......)))))).)))).......-...))))))........---------- ( -26.30, z-score = -4.09, R) >droYak2.chr3L 22294826 113 + 24197627 UAAAGUACAAUUACUAUUUACAUUGCA-GUCAAUUAAUGGUAAUAUUAUAACUAAAUGAGGAAGAGGACUUA-ACCUUUUACUUCAACUUAA-UAAUGGGUUGCCUCCACUGGGGC---- ..((((...(((((((((...((((..-..)))).)))))))))............(((((((((((.....-.)))))).)))))))))..-.........(((((....)))))---- ( -24.10, z-score = -1.47, R) >droEre2.scaffold_4784 21642463 119 + 25762168 UAAACCACAAUUAUUAUUUACAUUGCAGGGCAAUUAAUGGUAAUAUUAUAACUAAAUGAGGAACAGGGCCUA-ACCUUUUACUUCAACAAAAAUAAUGGGCAAAGUUUAUAUUUUUGUGC .........(((((((((...(((((...))))).)))))))))............(((((((.(((.....-.))).)).)))))(((((((((.(((((...)))))))))))))).. ( -22.00, z-score = -0.95, R) >consensus UAAACCACAAUUACUAUUUACAUUGCAAGGCAAUUAAUGGUAAUAUUAUAACUAAAUGAGGAAGAGGGCUAAUACCCUUUACUUCAACUCAA_UAAUGGGUUACCUAAAC__________ ..((((.(((((((((((...(((((...))))).))))))))).............((((.((((((......)))))).))))...........)))))).................. (-16.36 = -17.32 + 0.96)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:43:23 2011