| Sequence ID | dm3.chr3L |
|---|---|
| Location | 21,050,411 – 21,050,507 |
| Length | 96 |
| Max. P | 0.527662 |
| Location | 21,050,411 – 21,050,507 |
|---|---|
| Length | 96 |
| Sequences | 3 |
| Columns | 96 |
| Reading direction | forward |
| Mean pairwise identity | 84.72 |
| Shannon entropy | 0.21044 |
| G+C content | 0.27705 |
| Mean single sequence MFE | -13.84 |
| Consensus MFE | -10.95 |
| Energy contribution | -11.39 |
| Covariance contribution | 0.45 |
| Combinations/Pair | 1.06 |
| Mean z-score | -1.54 |
| Structure conservation index | 0.79 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.07 |
| SVM RNA-class probability | 0.527662 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 21050411 96 + 24543557 UACAGCUUUAUCAGUCUAAUUAGGGACAAAAAUGGCAUCUUAUGGUAUUCUUUAAAAUUCCAUUAUAAGAUUGCACUUUUCAUUUUAAUUAUUCCC .............((((......)))).((((((((((((((((((...............))))))))).)))......)))))).......... ( -12.66, z-score = -0.40, R) >droSec1.super_11 938840 96 + 2888827 UACAGCUUUAUCUGUCUAAUUAGAGACAAAAAUAGCAUCUUAUCCUAUUCUUUCAAAGUCCAUUAUAAGAUUGCACUUUUUUUUUUAAUUAUUCCC .((((......)))).((((((((((.(((((..(((((((((......((.....))......)))))).)))..)))))))))))))))..... ( -13.90, z-score = -2.32, R) >droSim1.chr3L 20404450 86 + 22553184 UACAGCUUUAUCUGUCUAAUUAGAGACAAAAAGAGCAUCUUAUGGUAUUCUUUCCAAUUCCAUUAUAAGAUUGCACAUUUUAUUUU---------- ....(((((.(.(((((......))))).).)))))((((((((((...............))))))))))...............---------- ( -14.96, z-score = -1.91, R) >consensus UACAGCUUUAUCUGUCUAAUUAGAGACAAAAAUAGCAUCUUAUGGUAUUCUUUCAAAUUCCAUUAUAAGAUUGCACUUUUUAUUUUAAUUAUUCCC .............((((......)))).......((((((((((((...............))))))))).)))...................... (-10.95 = -11.39 + 0.45)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:41:24 2011