| Sequence ID | dm3.chr3L |
|---|---|
| Location | 20,754,383 – 20,754,438 |
| Length | 55 |
| Max. P | 0.772931 |
| Location | 20,754,383 – 20,754,438 |
|---|---|
| Length | 55 |
| Sequences | 7 |
| Columns | 55 |
| Reading direction | reverse |
| Mean pairwise identity | 72.73 |
| Shannon entropy | 0.55985 |
| G+C content | 0.41027 |
| Mean single sequence MFE | -11.74 |
| Consensus MFE | -6.09 |
| Energy contribution | -7.10 |
| Covariance contribution | 1.01 |
| Combinations/Pair | 1.59 |
| Mean z-score | -1.19 |
| Structure conservation index | 0.52 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.64 |
| SVM RNA-class probability | 0.772931 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 20754383 55 - 24543557 AUUCAGGUUAAGAGGAAAUCGUGCUCACGAUUCGUAUGCGCUAUAUUUAAUUGAC ......(((((..(((.((.((((..(((...)))..)))).)).)))..))))) ( -9.00, z-score = -0.06, R) >droPer1.super_40 370080 51 - 810552 --ACAGG--GGCAGGGCAGCCUUUUUAAAACUCAUAAAUCAAGGAUUAAAUCGAC --..(((--(((......))))))............................... ( -5.90, z-score = -0.22, R) >droAna3.scaffold_13337 11109182 51 - 23293914 AUUCAGGUUAAGGAGCCGGUGUGUACACAGGGCGUAUGCGUGUUAUUUAGU---- ...((.((......(((.(((....)))..)))....)).)).........---- ( -10.40, z-score = -0.26, R) >droEre2.scaffold_4784 20445019 54 - 25762168 AUUCAGGUUAAGAGG-AAUCGUGCUCACGGUUCGUAUGCGCGAUAUUUAAUUGAC ......(((((..((-((((((((..(((...)))..))))))).)))..))))) ( -13.70, z-score = -1.64, R) >droYak2.chr3L 4402142 55 + 24197627 AUUUAGGUUAAGAAGAAAUCGUGUUCACGGUUCGUAUGCGCGAUAUUUAAUUGAC ......(((((..(((.(((((((..(((...)))..))))))).)))..))))) ( -13.40, z-score = -2.02, R) >droSec1.super_11 654014 55 - 2888827 AUUCAGGUUAAGAGGAAAUCGUGCUCACGUUUCGUAUGCGCGAUAUUUAAUUGAC ......(((((..(((.(((((((..(((...)))..))))))).)))..))))) ( -14.90, z-score = -2.20, R) >droSim1.chr3L 20110095 55 - 22553184 AUUCAGGUUAAGAGGAAAUCGUGCUCACGUCUCGUAUGCGCGAUAUUUAAUUGAC ......(((((..(((.(((((((..(((...)))..))))))).)))..))))) ( -14.90, z-score = -1.96, R) >consensus AUUCAGGUUAAGAGGAAAUCGUGCUCACGGUUCGUAUGCGCGAUAUUUAAUUGAC ......(((((..(((.(((((((..((.....))..))))))).)))..))))) ( -6.09 = -7.10 + 1.01)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:40:49 2011