| Sequence ID | dm3.chr3L |
|---|---|
| Location | 20,163,688 – 20,163,752 |
| Length | 64 |
| Max. P | 0.981425 |
| Location | 20,163,688 – 20,163,752 |
|---|---|
| Length | 64 |
| Sequences | 9 |
| Columns | 66 |
| Reading direction | forward |
| Mean pairwise identity | 90.06 |
| Shannon entropy | 0.21111 |
| G+C content | 0.35906 |
| Mean single sequence MFE | -11.34 |
| Consensus MFE | -9.41 |
| Energy contribution | -10.43 |
| Covariance contribution | 1.03 |
| Combinations/Pair | 1.12 |
| Mean z-score | -2.57 |
| Structure conservation index | 0.83 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.07 |
| SVM RNA-class probability | 0.981425 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 20163688 64 + 24543557 UUUUUGUUUACCACUUUGCACAUUCUGCUGUCAAAUUUGUUGAUUUAUAGUUCCCGAUGUGCCU-- .................(((((((..(((((.(((((....))))))))))....)))))))..-- ( -13.20, z-score = -3.30, R) >droSim1.chr3L 19451615 66 + 22553184 UUUUUGUUUACCACUUUGCACAUUCUGCUGUCAAAUUUGUUGAAUUAUAGUUCCCGAUGUGCCCCU .................(((((((..(((((..(((((...))))))))))....))))))).... ( -10.50, z-score = -2.20, R) >droSec1.super_11 73820 66 + 2888827 UUUUUGUUUACCACUUUGCACAUUCUGCUGUCAAAUUUGUUGAUUUAUAGUUCCCGAUGUGCCCCU .................(((((((..(((((.(((((....))))))))))....))))))).... ( -13.20, z-score = -3.70, R) >droYak2.chr3L 3793072 64 - 24197627 UUUUUGUUUACCACUUUGCACAUUCUGCUGUCAAAUUUGUUGAUUUAUAGUUCCCGAUGUGCCU-- .................(((((((..(((((.(((((....))))))))))....)))))))..-- ( -13.20, z-score = -3.30, R) >droEre2.scaffold_4784 19890368 64 + 25762168 UUUUUGUUUACCACUUUGCACAUUCUGCUGUCAAAUUUGUUGAUUUAUAGUUCCCGAUGUGCCU-- .................(((((((..(((((.(((((....))))))))))....)))))))..-- ( -13.20, z-score = -3.30, R) >droAna3.scaffold_13337 6284581 64 + 23293914 UUUUUGUUUACCACUUUGCACAUUCUGCUGUCAAAUUUGUUGAUUUAUAGUUCCCGAUGUGGCC-- ..................((((((..(((((.(((((....))))))))))....))))))...-- ( -10.50, z-score = -1.12, R) >dp4.chrXR_group6 2036949 64 + 13314419 UUUUUGUUUACCACUUUGCACAUUUUGCUGUCAAAUUUGUUGAUUUAUAGUUCCCGAUGUGCCU-- .................(((((((..(((((.(((((....))))))))))....)))))))..-- ( -13.20, z-score = -3.40, R) >droPer1.super_9 330079 64 + 3637205 UUUUUGUUUACCACUUUGCACAUUUUGCUGUCAAAUUUGUUGAUUUAUAGUUCCCGAUGUGCCU-- .................(((((((..(((((.(((((....))))))))))....)))))))..-- ( -13.20, z-score = -3.40, R) >droGri2.scaffold_15110 15426398 60 - 24565398 UUUUCUUUAACCAUUCUGCACUUUUUGC---CAAACAU-UUGAUUUAUAUCGCUCACUAUGCCU-- .................(((.....)))---.......-..(((....)))((.......))..-- ( -1.90, z-score = 0.58, R) >consensus UUUUUGUUUACCACUUUGCACAUUCUGCUGUCAAAUUUGUUGAUUUAUAGUUCCCGAUGUGCCU__ .................(((((((..(((((.(((((....))))))))))....))))))).... ( -9.41 = -10.43 + 1.03)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:39:20 2011