| Sequence ID | dm3.chr3L |
|---|---|
| Location | 19,475,674 – 19,475,724 |
| Length | 50 |
| Max. P | 0.690342 |
| Location | 19,475,674 – 19,475,724 |
|---|---|
| Length | 50 |
| Sequences | 4 |
| Columns | 50 |
| Reading direction | forward |
| Mean pairwise identity | 85.67 |
| Shannon entropy | 0.23226 |
| G+C content | 0.42500 |
| Mean single sequence MFE | -10.60 |
| Consensus MFE | -10.43 |
| Energy contribution | -10.05 |
| Covariance contribution | -0.38 |
| Combinations/Pair | 1.17 |
| Mean z-score | -0.74 |
| Structure conservation index | 0.98 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.43 |
| SVM RNA-class probability | 0.690342 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 19475674 50 + 24543557 AGUUGAGACAGCAUUGGAGGAUACAUUUUCCAAACAUCCCUUGCCUGGGA .((((...)))).((((((((....))))))))...((((......)))) ( -13.20, z-score = -1.07, R) >droSim1.chr3L 18807235 50 + 22553184 AGUUCAUACCGCAUUGGAGGAUACAUUUUCCAAACAUCCUUUGCAUGGGA ........(((((..((((((.......))).....)))..)))..)).. ( -9.80, z-score = -0.56, R) >droSec1.super_29 179634 50 + 700605 AGUUCAUACCGCAUUGGAGGAUACAUUUUCCAAACAUCCUUUGCAUGGGA ........(((((..((((((.......))).....)))..)))..)).. ( -9.80, z-score = -0.56, R) >droEre2.scaffold_4784 6567716 50 - 25762168 AUUUCGAACACCCUUGGAGAAAACUUUUUCCAAACAUCCUUUUCCUGGGA .............((((((((....))))))))...((((......)))) ( -9.60, z-score = -0.78, R) >consensus AGUUCAUACAGCAUUGGAGGAUACAUUUUCCAAACAUCCUUUGCAUGGGA .............((((((((....))))))))...((((......)))) (-10.43 = -10.05 + -0.38)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:37:51 2011