| Sequence ID | dm3.chr3L |
|---|---|
| Location | 18,225,728 – 18,225,791 |
| Length | 63 |
| Max. P | 0.939967 |
| Location | 18,225,728 – 18,225,791 |
|---|---|
| Length | 63 |
| Sequences | 3 |
| Columns | 63 |
| Reading direction | reverse |
| Mean pairwise identity | 93.51 |
| Shannon entropy | 0.08746 |
| G+C content | 0.39817 |
| Mean single sequence MFE | -9.20 |
| Consensus MFE | -9.00 |
| Energy contribution | -9.00 |
| Covariance contribution | 0.00 |
| Combinations/Pair | 1.00 |
| Mean z-score | -1.69 |
| Structure conservation index | 0.98 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.46 |
| SVM RNA-class probability | 0.939967 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 18225728 63 - 24543557 ACUCUAGGACAAGUGUAUGGAGGAAUACGAAAAAAGGCUGAAAAGUGGGGAGAACAUAUAAUA .((((........(((((......))))).......(((....)))..))))........... ( -9.20, z-score = -1.80, R) >droSim1.chr3L 17555569 59 - 22553184 ACUCUAGGACAAGUGUAUGGAGGAAUACG--AAAAGGCUGAAAAGUGGGGAGAACAUAAUA-- .((((........(((((......)))))--.....(((....)))..)))).........-- ( -9.20, z-score = -1.63, R) >droSec1.super_19 220122 59 - 1257711 ACUCUAGGACAAGUGUAUGGAGGAAUACG--AAAAGGCUGAAAAGUGGGGAGAACAUAAUA-- .((((........(((((......)))))--.....(((....)))..)))).........-- ( -9.20, z-score = -1.63, R) >consensus ACUCUAGGACAAGUGUAUGGAGGAAUACG__AAAAGGCUGAAAAGUGGGGAGAACAUAAUA__ .((((.........((((......))))........(((....)))..))))........... ( -9.00 = -9.00 + 0.00)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:35:21 2011