| Sequence ID | dm3.chr3L |
|---|---|
| Location | 17,826,622 – 17,826,678 |
| Length | 56 |
| Max. P | 0.954499 |
| Location | 17,826,622 – 17,826,678 |
|---|---|
| Length | 56 |
| Sequences | 3 |
| Columns | 56 |
| Reading direction | forward |
| Mean pairwise identity | 67.86 |
| Shannon entropy | 0.44275 |
| G+C content | 0.59524 |
| Mean single sequence MFE | -19.33 |
| Consensus MFE | -10.48 |
| Energy contribution | -12.15 |
| Covariance contribution | 1.67 |
| Combinations/Pair | 1.23 |
| Mean z-score | -2.20 |
| Structure conservation index | 0.54 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.61 |
| SVM RNA-class probability | 0.954499 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 17826622 56 + 24543557 GGAGGACACCUGGCUGCUGUGGAGGAUCAGAACGACCAGGACGGCCAGGGAGAGAG ........((((((((.(.(((.(........)..))).).))))))))....... ( -19.80, z-score = -1.98, R) >droSim1.chr3L 17166481 56 + 22553184 GGAGGACACCUGGCUGCUCUGGAGGAUCAGAACGACCAGGACGGCCAGGGAGAGAG ........((((((((..((((.(........)..))))..))))))))....... ( -24.10, z-score = -3.18, R) >droAna3.scaffold_13337 17909003 56 - 23293914 AUCGGCAACCGGGGUUCUCAGGACGAGAAUCGUUGCAAGGAUAGUUAUGGUAAGAG (((.(((((...(((((((.....))))))))))))...))).............. ( -14.10, z-score = -1.43, R) >consensus GGAGGACACCUGGCUGCUCUGGAGGAUCAGAACGACCAGGACGGCCAGGGAGAGAG ........((((((((.(((((.............))))).))))))))....... (-10.48 = -12.15 + 1.67)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:34:40 2011