| Sequence ID | dm3.chr3L |
|---|---|
| Location | 17,736,719 – 17,736,783 |
| Length | 64 |
| Max. P | 0.538222 |
| Location | 17,736,719 – 17,736,783 |
|---|---|
| Length | 64 |
| Sequences | 8 |
| Columns | 68 |
| Reading direction | forward |
| Mean pairwise identity | 61.82 |
| Shannon entropy | 0.76165 |
| G+C content | 0.48056 |
| Mean single sequence MFE | -11.71 |
| Consensus MFE | -4.90 |
| Energy contribution | -4.50 |
| Covariance contribution | -0.41 |
| Combinations/Pair | 1.83 |
| Mean z-score | -0.59 |
| Structure conservation index | 0.42 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.09 |
| SVM RNA-class probability | 0.538222 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 17736719 64 + 24543557 AGCCGGGGCCAAAACAUUCAAAAUAUCCUUGCUUUGGCUUCAUCCUUCUGUAACCACCUACCAU---- ....(((((((((.((.............)).))))))))).......................---- ( -12.02, z-score = -1.03, R) >droSim1.chr3L 17070874 64 + 22553184 AGCCGGGGCCAAAACAUUCAAAAUAUCCUUGCUCUGGCUUCAUCCUUCUGGAACCACCUACCAU---- (((((((((.....................)))))))))...(((....)))............---- ( -15.10, z-score = -1.62, R) >droSec1.super_0 9781150 68 + 21120651 AGCCGGGGCCAAAACAUUUAAAAUAUCCUUGCUCUGGCUUCAUCCUUCUGUAACCACCUACCAUUCAU (((((((((.....................)))))))))............................. ( -12.40, z-score = -1.30, R) >droYak2.chr3L 7875777 63 - 24197627 AGCCGGGGCCAAAACAUUCAAAAUAUCCUUGCUGUG-CUCCGUCCUUCUGUGACCACCUCCCAC---- ....(((((((.....................)).)-))))((((....).)))..........---- ( -8.70, z-score = 0.79, R) >droEre2.scaffold_4784 9638280 66 - 25762168 AGCCGGGGCCAAAACAUUCCAAAUAUCCUUGCUC-GGCUCCAUCCUUCUGUGACCAACU-CCACCCAU ....((((((........................-))))))........(((.......-.))).... ( -10.66, z-score = 0.17, R) >droWil1.scaffold_180923 37507 63 + 67496 AGCAGAAACAAAAAAGCUCCAAAAAUAUUUACCUUUCCUUGAUU-UCCUGAUACAAUCGAACUU---- ..(((((((((.((((................))))..))).))-).)))..............---- ( -1.69, z-score = 0.94, R) >droVir3.scaffold_13049 18526019 57 - 25233164 CGCAGAGGCCGAAAGGCAUUAGGAGUCC-------GGUUUCAUGUAUUUGCUUGUCCGCCUCCU---- .......(((....)))...(((((..(-------((...((.((....)).)).))).)))))---- ( -18.50, z-score = -1.57, R) >droMoj3.scaffold_6680 19729598 58 - 24764193 CGCAGAGGCCAAAAGGCAUUAGAGUCCCC------GGUUUCAUGUAUUUGCCAGCACGCCUCAU---- ....(((((.....((((.(((((.(...------.).))).))....)))).....)))))..---- ( -14.60, z-score = -1.09, R) >consensus AGCCGGGGCCAAAACAUUCAAAAUAUCCUUGCUCUGGCUUCAUCCUUCUGUAACCACCUACCAU____ ....((((((.........................))))))........................... ( -4.90 = -4.50 + -0.41)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:34:30 2011