| Sequence ID | dm3.chr3L |
|---|---|
| Location | 16,872,966 – 16,873,018 |
| Length | 52 |
| Max. P | 0.884331 |
| Location | 16,872,966 – 16,873,018 |
|---|---|
| Length | 52 |
| Sequences | 3 |
| Columns | 52 |
| Reading direction | reverse |
| Mean pairwise identity | 67.95 |
| Shannon entropy | 0.44149 |
| G+C content | 0.29897 |
| Mean single sequence MFE | -10.53 |
| Consensus MFE | -6.41 |
| Energy contribution | -5.53 |
| Covariance contribution | -0.87 |
| Combinations/Pair | 1.47 |
| Mean z-score | -1.66 |
| Structure conservation index | 0.61 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.06 |
| SVM RNA-class probability | 0.884331 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 16872966 52 - 24543557 AUGAGUUCUUUUCUAUGGGAAUUCCCAGUUUGAAAUAGAAAGAAUUUGAAUG ..(((((((((.(((((((....))))........))))))))))))..... ( -12.40, z-score = -2.02, R) >droSec1.super_0 8943403 52 - 21120651 AUGAGUUCUUUUCUAUGGGAAUUACCAGUUUGAAAUAGAAAGAAUUUAAAUG .((((((((((.((((..((((.....))))...)))))))))))))).... ( -11.20, z-score = -2.20, R) >droEre2.scaffold_4784 8800732 50 + 25762168 --AUACUUUUUGUUGGGUGCAUUACCAUUUUAGAGUAAGAGGAUUAUGUAUG --.((((((....(((........)))....))))))............... ( -8.00, z-score = -0.77, R) >consensus AUGAGUUCUUUUCUAUGGGAAUUACCAGUUUGAAAUAGAAAGAAUUUGAAUG ..(((((((((.((((..((((.....))))...)))))))))))))..... ( -6.41 = -5.53 + -0.87)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:32:16 2011