| Sequence ID | dm3.chr3L |
|---|---|
| Location | 16,847,473 – 16,847,576 |
| Length | 103 |
| Max. P | 0.998330 |
| Location | 16,847,473 – 16,847,576 |
|---|---|
| Length | 103 |
| Sequences | 4 |
| Columns | 103 |
| Reading direction | forward |
| Mean pairwise identity | 77.89 |
| Shannon entropy | 0.35692 |
| G+C content | 0.37935 |
| Mean single sequence MFE | -25.15 |
| Consensus MFE | -21.17 |
| Energy contribution | -21.18 |
| Covariance contribution | 0.00 |
| Combinations/Pair | 1.33 |
| Mean z-score | -3.10 |
| Structure conservation index | 0.84 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 3.32 |
| SVM RNA-class probability | 0.998330 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 16847473 103 + 24543557 GCGUGUGUGUGUGUGCAUGGCCGUAAAGGCUGACUGACUGAUAAAAAAGGAAACAAAAAAAUAACAAGAAAAUAAAAUAUACACAUACACACACACACCAACG (.(((((((((((((...((((.....)))).................(....)...........................))))))))))))).)....... ( -29.80, z-score = -4.79, R) >droSim1.chr3L 16191350 102 + 22553184 GCGUGUGUGUGUGUGCAUGGCCGUAAAGGCUGACUGACUGAUAAAAAAGGAAACAAAAAAAUAACAAGAAAAAUAAA-AUACACACAUACACACACACCAACG (.(((((((((((((...((((.....)))).................(....).......................-...))))))))))))).)....... ( -29.80, z-score = -4.85, R) >droSec1.super_0 8917851 102 + 21120651 GCGUGUGUGUGUGUGCAUGGCCGUAAAGGCUGACUGACUGAUAAAAAAGGAAACAAAAAAAUAACAAGAAAAAUAAU-AUAUACACAUAGACACACACCAACG ..((((((.((((((...((((.....)))).................(....).......................-.....)))))).))))))....... ( -25.80, z-score = -3.75, R) >anoGam1.chr3L 10986067 99 - 41284009 --GUGUGUGUGUGUCGGUGUGAGAGAGUGACGUUUGACACAGAAACAACAACACAAAAAAACGAUAAAAAAGAAAGA--AACAUUAACACAAAUCCACCAACG --.(((((.(((.((.((((.(((........))).)))).)).)))...)))))......................--........................ ( -15.20, z-score = 0.98, R) >consensus GCGUGUGUGUGUGUGCAUGGCCGUAAAGGCUGACUGACUGAUAAAAAAGGAAACAAAAAAAUAACAAGAAAAAAAAA_AUACACACACACACACACACCAACG ..(((((((((((((...((((.....)))).................(....)...............................)))))))))))))..... (-21.17 = -21.18 + 0.00)
| Location | 16,847,473 – 16,847,576 |
|---|---|
| Length | 103 |
| Sequences | 4 |
| Columns | 103 |
| Reading direction | reverse |
| Mean pairwise identity | 77.89 |
| Shannon entropy | 0.35692 |
| G+C content | 0.37935 |
| Mean single sequence MFE | -22.35 |
| Consensus MFE | -17.50 |
| Energy contribution | -19.25 |
| Covariance contribution | 1.75 |
| Combinations/Pair | 1.14 |
| Mean z-score | -2.02 |
| Structure conservation index | 0.78 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.87 |
| SVM RNA-class probability | 0.972696 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 16847473 103 - 24543557 CGUUGGUGUGUGUGUGUAUGUGUAUAUUUUAUUUUCUUGUUAUUUUUUUGUUUCCUUUUUUAUCAGUCAGUCAGCCUUUACGGCCAUGCACACACACACACGC .....(((((((((((((((.(((.....))).........................................(((.....)))))))))))))))))).... ( -27.70, z-score = -3.60, R) >droSim1.chr3L 16191350 102 - 22553184 CGUUGGUGUGUGUGUAUGUGUGUAU-UUUAUUUUUCUUGUUAUUUUUUUGUUUCCUUUUUUAUCAGUCAGUCAGCCUUUACGGCCAUGCACACACACACACGC .....((((((((((..((((((((-.......................................(.....).(((.....))).)))))))))))))))))) ( -25.50, z-score = -3.00, R) >droSec1.super_0 8917851 102 - 21120651 CGUUGGUGUGUGUCUAUGUGUAUAU-AUUAUUUUUCUUGUUAUUUUUUUGUUUCCUUUUUUAUCAGUCAGUCAGCCUUUACGGCCAUGCACACACACACACGC .....((((((((...(((((((..-.......................................(.....).(((.....))).))))))).)))))))).. ( -20.90, z-score = -2.10, R) >anoGam1.chr3L 10986067 99 + 41284009 CGUUGGUGGAUUUGUGUUAAUGUU--UCUUUCUUUUUUAUCGUUUUUUUGUGUUGUUGUUUCUGUGUCAAACGUCACUCUCUCACACCGACACACACACAC-- ...(((((((..(((....)))..--))....................(((((((.(((....(((.(....).)))......))).)))))))))).)).-- ( -15.30, z-score = 0.62, R) >consensus CGUUGGUGUGUGUGUAUGUGUGUAU_UUUAUUUUUCUUGUUAUUUUUUUGUUUCCUUUUUUAUCAGUCAGUCAGCCUUUACGGCCAUGCACACACACACACGC .....(((((((((((((((((...........................................(.....).(((.....)))))))))))))))))))).. (-17.50 = -19.25 + 1.75)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:32:12 2011