| Sequence ID | dm3.chr3L |
|---|---|
| Location | 16,152,681 – 16,152,775 |
| Length | 94 |
| Max. P | 0.726356 |
| Location | 16,152,681 – 16,152,775 |
|---|---|
| Length | 94 |
| Sequences | 3 |
| Columns | 94 |
| Reading direction | reverse |
| Mean pairwise identity | 84.76 |
| Shannon entropy | 0.20247 |
| G+C content | 0.36112 |
| Mean single sequence MFE | -14.65 |
| Consensus MFE | -11.92 |
| Energy contribution | -11.92 |
| Covariance contribution | -0.00 |
| Combinations/Pair | 1.00 |
| Mean z-score | -1.72 |
| Structure conservation index | 0.81 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.52 |
| SVM RNA-class probability | 0.726356 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 16152681 94 - 24543557 AUAUAAAAAAAAAACACCAGACACACACUCAUACACACACAAGACAUGAAGGUUCACCGAAUAUCUGGAAUUUGGGGGCUUUCUUUUGUCUAAA .........................................(((((.((((((((.((((((.......))))))))))))))...)))))... ( -19.90, z-score = -2.85, R) >droSec1.super_0 8252124 77 - 21120651 AUAUAAAAAAAA-----CAGACACACACACACACAC------------AAGGUUCACCGAAUAUCUGGAAUUUGGGGGCUUUCUUUUGUCUAAA ............-----.(((((.............------------(((((((.((((((.......)))))))))))))....)))))... ( -12.03, z-score = -1.28, R) >droSim1.chr3L 15486001 81 - 22553184 AUAUAAAAAAAAAA-AACAGACACACACACACGCAC------------AAGGUUCACCGAAUAUCUGGAAUUUGGGGGCUUUCUUUUGUCUAAA ..............-...(((((.............------------(((((((.((((((.......)))))))))))))....)))))... ( -12.03, z-score = -1.03, R) >consensus AUAUAAAAAAAAAA_A_CAGACACACACACACACAC____________AAGGUUCACCGAAUAUCUGGAAUUUGGGGGCUUUCUUUUGUCUAAA ..................(((((.........................(((((((.((((((.......)))))))))))))....)))))... (-11.92 = -11.92 + -0.00)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:30:42 2011