| Sequence ID | dm3.chr3L |
|---|---|
| Location | 15,724,725 – 15,724,776 |
| Length | 51 |
| Max. P | 0.981386 |
| Location | 15,724,725 – 15,724,776 |
|---|---|
| Length | 51 |
| Sequences | 5 |
| Columns | 51 |
| Reading direction | reverse |
| Mean pairwise identity | 98.82 |
| Shannon entropy | 0.01904 |
| G+C content | 0.36471 |
| Mean single sequence MFE | -17.00 |
| Consensus MFE | -17.00 |
| Energy contribution | -17.00 |
| Covariance contribution | 0.00 |
| Combinations/Pair | 1.00 |
| Mean z-score | -2.19 |
| Structure conservation index | 1.00 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.07 |
| SVM RNA-class probability | 0.981386 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 15724725 51 - 24543557 GAUGCUAAUUGCAUUUGGCCAUUAAAUGCAUAAUUUGCCAUUGAUGGCAUG (((((.....)))))..((((((((..(((.....)))..))))))))... ( -17.00, z-score = -2.24, R) >droSim1.chr3L 15063642 51 - 22553184 GAUGCUAAUUGCAUUUGGCCAUUAAAUGCAUAAUUUGCCAUUGAUGGCAUU (((((.....)))))..((((((((..(((.....)))..))))))))... ( -17.00, z-score = -2.10, R) >droSec1.super_0 7835803 51 - 21120651 GAUGCUAAUUGCAUUUGGCCAUUAAAUGCAUAAUUUGCCAUUGAUGGCAUU (((((.....)))))..((((((((..(((.....)))..))))))))... ( -17.00, z-score = -2.10, R) >droYak2.chr3L 18275701 51 - 24197627 GAUGCUAAUUGCAUUUGGCCAUUAAAUGCAUAAUUUGCCAUUGAUGGCAUG (((((.....)))))..((((((((..(((.....)))..))))))))... ( -17.00, z-score = -2.24, R) >droEre2.scaffold_4784 17980692 51 - 25762168 GAUGCUAAUUGCAUUUGGCCAUUAAAUGCAUAAUUUGCCAUUGAUGGCAUG (((((.....)))))..((((((((..(((.....)))..))))))))... ( -17.00, z-score = -2.24, R) >consensus GAUGCUAAUUGCAUUUGGCCAUUAAAUGCAUAAUUUGCCAUUGAUGGCAUG (((((.....)))))..((((((((..(((.....)))..))))))))... (-17.00 = -17.00 + 0.00)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:29:42 2011