| Sequence ID | dm3.chr3L |
|---|---|
| Location | 15,708,759 – 15,708,818 |
| Length | 59 |
| Max. P | 0.994700 |
| Location | 15,708,759 – 15,708,818 |
|---|---|
| Length | 59 |
| Sequences | 6 |
| Columns | 60 |
| Reading direction | forward |
| Mean pairwise identity | 96.07 |
| Shannon entropy | 0.07584 |
| G+C content | 0.44633 |
| Mean single sequence MFE | -20.48 |
| Consensus MFE | -20.37 |
| Energy contribution | -20.40 |
| Covariance contribution | 0.03 |
| Combinations/Pair | 1.05 |
| Mean z-score | -2.70 |
| Structure conservation index | 0.99 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 2.73 |
| SVM RNA-class probability | 0.994700 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 15708759 59 + 24543557 UUGAGUUUACAGUGCAGUCAGCUCAUUAGUGAGUCUGUUUGCCAUUGUGGCUCUUGUCU- ..(((((.(((((((((.(((((((....)))).))).))).)))))))))))......- ( -20.90, z-score = -3.02, R) >droSim1.chr3L 15047775 59 + 22553184 UUGAGUUUACAGUGCAGUCAGCUCAUUAGUGAGUCUGUUUGCCAUUGUGGCUCUUGUCU- ..(((((.(((((((((.(((((((....)))).))).))).)))))))))))......- ( -20.90, z-score = -3.02, R) >droSec1.super_0 7819843 59 + 21120651 UUGAGUUUACAGUGCAGUCAGCUCAUUAGUGAGUCUGUUUGCCAUUGUGGCUCUUGUCU- ..(((((.(((((((((.(((((((....)))).))).))).)))))))))))......- ( -20.90, z-score = -3.02, R) >droYak2.chr3L 18259446 59 + 24197627 UUGAGUUUACAGUGCAGUCAGCUCAUUAGUGAGUCUGUUUGCCAUUGUGGCUCUUGUCU- ..(((((.(((((((((.(((((((....)))).))).))).)))))))))))......- ( -20.90, z-score = -3.02, R) >droEre2.scaffold_4784 17965054 59 + 25762168 UUGAGUUUACAGUGCAGUCAGCUCAUUAGUGAGUCUGUUUGCCAUUGUGGCUCUUGUCU- ..(((((.(((((((((.(((((((....)))).))).))).)))))))))))......- ( -20.90, z-score = -3.02, R) >droAna3.scaffold_13337 11848143 59 - 23293914 UUGA-CUUACAGUGCAGUCAGCUCAUUAGUGAGUCUGUUUGCCAUUGUGGCUCUGGCUCU ..((-.(((((((((((.(((((((....)))).))).))).)))))))).))....... ( -18.40, z-score = -1.07, R) >consensus UUGAGUUUACAGUGCAGUCAGCUCAUUAGUGAGUCUGUUUGCCAUUGUGGCUCUUGUCU_ ..(((((.(((((((((.(((((((....)))).))).))).)))))))))))....... (-20.37 = -20.40 + 0.03)
| Location | 15,708,759 – 15,708,818 |
|---|---|
| Length | 59 |
| Sequences | 6 |
| Columns | 60 |
| Reading direction | reverse |
| Mean pairwise identity | 96.07 |
| Shannon entropy | 0.07584 |
| G+C content | 0.44633 |
| Mean single sequence MFE | -14.17 |
| Consensus MFE | -13.53 |
| Energy contribution | -13.70 |
| Covariance contribution | 0.17 |
| Combinations/Pair | 1.00 |
| Mean z-score | -1.90 |
| Structure conservation index | 0.96 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 1.52 |
| SVM RNA-class probability | 0.945960 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 15708759 59 - 24543557 -AGACAAGAGCCACAAUGGCAAACAGACUCACUAAUGAGCUGACUGCACUGUAAACUCAA -......(((..(((...(((..(((.((((....)))))))..)))..)))...))).. ( -14.20, z-score = -2.15, R) >droSim1.chr3L 15047775 59 - 22553184 -AGACAAGAGCCACAAUGGCAAACAGACUCACUAAUGAGCUGACUGCACUGUAAACUCAA -......(((..(((...(((..(((.((((....)))))))..)))..)))...))).. ( -14.20, z-score = -2.15, R) >droSec1.super_0 7819843 59 - 21120651 -AGACAAGAGCCACAAUGGCAAACAGACUCACUAAUGAGCUGACUGCACUGUAAACUCAA -......(((..(((...(((..(((.((((....)))))))..)))..)))...))).. ( -14.20, z-score = -2.15, R) >droYak2.chr3L 18259446 59 - 24197627 -AGACAAGAGCCACAAUGGCAAACAGACUCACUAAUGAGCUGACUGCACUGUAAACUCAA -......(((..(((...(((..(((.((((....)))))))..)))..)))...))).. ( -14.20, z-score = -2.15, R) >droEre2.scaffold_4784 17965054 59 - 25762168 -AGACAAGAGCCACAAUGGCAAACAGACUCACUAAUGAGCUGACUGCACUGUAAACUCAA -......(((..(((...(((..(((.((((....)))))))..)))..)))...))).. ( -14.20, z-score = -2.15, R) >droAna3.scaffold_13337 11848143 59 + 23293914 AGAGCCAGAGCCACAAUGGCAAACAGACUCACUAAUGAGCUGACUGCACUGUAAG-UCAA ...((.((.(((.....)))...(((.((((....))))))).))))........-.... ( -14.00, z-score = -0.66, R) >consensus _AGACAAGAGCCACAAUGGCAAACAGACUCACUAAUGAGCUGACUGCACUGUAAACUCAA .......(((..(((...(((..(((.((((....)))))))..)))..)))...))).. (-13.53 = -13.70 + 0.17)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:29:37 2011