| Sequence ID | dm3.chr3L |
|---|---|
| Location | 15,621,719 – 15,621,817 |
| Length | 98 |
| Max. P | 0.606263 |
| Location | 15,621,719 – 15,621,817 |
|---|---|
| Length | 98 |
| Sequences | 6 |
| Columns | 98 |
| Reading direction | reverse |
| Mean pairwise identity | 90.00 |
| Shannon entropy | 0.19004 |
| G+C content | 0.32313 |
| Mean single sequence MFE | -24.25 |
| Consensus MFE | -16.93 |
| Energy contribution | -17.18 |
| Covariance contribution | 0.26 |
| Combinations/Pair | 1.30 |
| Mean z-score | -2.10 |
| Structure conservation index | 0.70 |
| Background model | dinucleotide |
| Decision model | sequence based alignment quality |
| SVM decision value | 0.24 |
| SVM RNA-class probability | 0.606263 |
| Prediction | RNA |
| WARNING | Out of training range. z-scores are NOT reliable. |
Download alignment: ClustalW | MAF
>dm3.chr3L 15621719 98 - 24543557 UUAGCGAUUGGUUAAUUAAAUUAGGCAGUUCGAUAUUGAUUGCAUUUGCAAAUGUAAUUAACAUUUGCGGUGCUCUAUCAGGUUUAUUAAAGUGCAAA (((((.....))))).........(((.((..((((((((.(((((.((((((((.....)))))))))))))...)))))...)))..)).)))... ( -25.40, z-score = -2.43, R) >droSim1.chr3L 14961158 98 - 22553184 UUAGCGAUUGGUUAAUUAAAUUAGGCAGUUCGAUAUUGAUUGCAUUUGCAAAUGUAAUUAACAUUUGCGGUGCUUUAUCGGGUUUAUUAAAGUGCAAA ...(((((..((..((..((((....))))..))))..)))))...(((((((((.....)))))))))(..(((((..........)))))..)... ( -24.70, z-score = -2.26, R) >droSec1.super_0 7734371 98 - 21120651 UUAGCGAUUGGUUAAUUAAAUUAGGCAGUUCGAUAUUGAUUGCAUUUGCAAAUGUAAUUAACAUUUGCGGUGCUUUAUCAGGUUUAUUAAAGUGCAAA (((((.....))))).........(((.((..((((((((.(((((.((((((((.....)))))))))))))...)))))...)))..)).)))... ( -25.40, z-score = -2.59, R) >droYak2.chr3L 18169877 98 - 24197627 UUAGCGAUUGGUUAAUUCAAUUAGGCUGUUCGAUAUUGAUUGCAUUUGCAAAAGUAAUUAACAUUUGCGGUGCUUCAUCAGGUUUAUUACAGUGCAAA ...((((((((.....))))))..(((((......(((((.(((((.(((((.((.....)).))))))))))...))))).......)))))))... ( -23.72, z-score = -1.68, R) >droEre2.scaffold_4784 17879822 98 - 25762168 UUAGCGAUUGGUUAAUUAAAUUAGGCAGUUCGAUACUGAUUGCAUUUGCAAAAGUAAUUAACAUUUGGGGUGCUUUAUCAGGUUUAUUAAAGUGCAAA (((((.....))))).........(((.((..((((((((.((((((.((((.((.....)).))))))))))...)))))...)))..)).)))... ( -20.30, z-score = -1.14, R) >droAna3.scaffold_13337 11757017 98 + 23293914 UCGGCGCUUUGUUAAUUCAAUUAGGAAGUUCGAUAUUGAUUGAAUUUGCAAGUGUGAUUAGCGUUCGGCACAUUUUAUUGGGUUUAUAAAAGUGCAAA ...(((((((...((((((((..(.(((((((((....))))))))).)..((((((.......)).)))).....))))))))....)))))))... ( -26.00, z-score = -2.51, R) >consensus UUAGCGAUUGGUUAAUUAAAUUAGGCAGUUCGAUAUUGAUUGCAUUUGCAAAUGUAAUUAACAUUUGCGGUGCUUUAUCAGGUUUAUUAAAGUGCAAA ...(((((((.(((((...))))).))))).....(((((.(((((.((((((((.....)))))))))))))...)))))............))... (-16.93 = -17.18 + 0.26)
Generated by rnazCluster.pl (part of RNAz 1.0) on Tue Apr 19 23:29:21 2011